search for




 

J Korean Med Rehabi 2020 Jan; 30(1): 1-12  https://doi.org/10.18325/jkmr.2020.30.1.1
Effects of Herbal Prescription on Obesity Related Hormones in Rats with Estrogen Deficiency
Published online January 31, 2020
Copyright © 2020 The Society of Korean Medicine Rehabilitation.

Jung-Sik Park, K.M.D., Ph.D., Jeong Seol Lim, K.M.D., Ph.D., Hyung-Ho Lim, K.M.D., Ph.D., Gwi Seo Hwang, Ph.D.

College of Korean Medicine, Gachon University
Correspondence to: Hyung-Ho Lim, College of Korean Medicine, Gachon University, 1342 Seongnam-daero, Sujeong-gu, Seongnam 13120, Korea
TEL +82-031-750-8599
FAX +82-031-750-5416
E-mail: omdlimhh@gachon.ac.kr
Received: June 25, 2019; Revised: December 30, 2019; Accepted: January 13, 2019
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Objectives Depletion of ovarian function after menopause in women induces estrogen deficiency leading to increased fat and decreased muscle mass. In this study, we examined the effect of herbal medicines by measuring hormone expression in muscle tissue of estrogen-deficient rats induced by ovariectomy.
Methods Ovariectomy was performed to induce estrogen deficiency, and mice were given herbal prescription (HP) for 6 weeks. Estrogen-deficient rats were divided into two groups: one group (HPH) which were orally administered HP 200 mg/kg and the other group (HPL) administered HP 40 mg/kg. Weight changes in both groups were measured using polymerase chain reaction (PCR). After extraction of the femoral muscles in mice, the expression of the leptin, lipoprotein lipase (LPL), diacyl glycerol acyltransferase (DGAT)1, peroxisome proliferator-activated receptor-γ coactivator (PGC)-1α, NADH dehydrogenase (NDH), farnesyl diphosphate farnesyltransferase (FDFT)1, lanosterol synthase (LSS), phosphatidylethanolamine N-methyltransferase (PEMT), and peroxiredoxin (Prdx6) were measured using PCR.
Results HP increased the expression of leptin, LPL, DGAT1, PGC-1α, NDH, FDFT1, LSS, PEMT, and Prdx6. HP affects body fat metabolism and is effective in improving menopausal obesity and obesity complications caused by estrogen deficiency. However, HP does not affect the expression of tumor necrosis factor-α and 3-hydroxy- 3-methylglutaryl-CoA reductase, and thus will not be effective in obesity-related metabolic diseases.
Conclusions HP is thought to inhibit weight gain by regulating hormone expression related to glucose metabolism and lipid metabolism in muscle tissue of estrogen-deficient rats.
Keywords : Obesity, Estrogens, Herbal medicine
서론»»»

여성호르몬인 에스트로겐 결핍은 갱년기 여성들에게 나타나는 비만의 주요한 원인으로 알려져 있다. 에스트로겐은 hypothalamus에서 leptin 분비 억제, 음식섭취 억제, 근육 운동량의 증가 작용을 나타내며, 지방세포에서 lipogenesis 억제, lipolysis 증가, 지방세포 분화인자 발현 억제 등의 작용을 나타내어 비만 발생을 억제한다1). 그러나 갱년기 여성의 에스트로겐 감소는 혈중 follicle-stimulating hormone 증가, testosterone의 상대적 증가, 기초 대사량 감소, sex hormone binding globulin 감소 등을 수반하여 지방대사 저하, 당 흡수 증가로 인해 체지방이 증가하여 비만을 유발한다2,3).

비만은 당뇨병, 고지혈증, 고혈압 및 관상동맥 질환의 원인으로 작용하며 대장암, 전립선암, 담낭암, 자궁경부암, 자궁내막암, 난소암, 유방암 등의 유병률을 증가시키고4,5), 담석 및 담관질환, 골관절염, 월경불순, 과월경증, 심리적 장애 등 다양한 건강 장해를 야기한다4,6). 특히 에스트로겐 결핍으로 인한 근육량 감소는 에너지 소비 감소로 이어져 비만 합병증을 심화시킨다7,8). 비만환자의 경우 지방세포의 활성이 증가하고, 이 세포로부터 세포 성장 및 조절인자의 발현과 분비가 증가하여 심혈관계 질환이나 대사성질환을 일으킬 수 있다. 특히 여성 비만 환자의 경우 자궁경부암, 자궁내막암, 난소암, 유방암, 월경불순, 과월경증 등 남성 비만 환자에 비해 더 많은 종류의 문제가 야기될 수 있다. 따라서 폐경기 비만을 치료하기 위해서는 지방세포의 기능을 억제하는 에스트로겐과 관련된 호르몬 연구가 매우 중요할 수 있다고 판단된다.

한의학에서 비만은 ⌈素問⋅通評虛實論⌋에서 “肥貴人,則膏粱之疾也”라고 하였고, ⌈素問⋅奇病論⌋에서 “人必數食甘味而多肥也”라고 하여 처음 언급되었고, 비만을 肥, 肥胖, 肥人, 肉人, 肥貴人 등으로 표현하고 있으며, 원인으로는 甘味와 膏粱厚味 등을 섭취하여 발생한다고 하였다9). 처방으로는 주로 太陰調胃湯, 淸肺瀉肝湯, 葛根承氣湯, 承氣調胃湯 등의 四象方과 五積散, 防風通聖散, 防己黃氣湯 등의 後世方이 많이 사용되었고, 단미제로 麻黃, 甘草, 大黃, 茯苓, 薏苡仁 등이 주로 연구되고 있다10). 한의학계에 이미 보고된 비만에 대한 연구 중 이상의 본초나 처방에 대한 연구들은 많이 진행되었으나 에스트로겐 결핍성 비만에 대한 직접적인 연구는 4편에 불과하였다11-14). 이 중 Lee 등14)이 2018년에 보고한 연구를 제외하고는 3편이 단미제에 대한 연구이다. 이에 본 연구에서는 새로운 시도로 갱년기 여성의 에스트로겐 결핍으로 유발되는 비만에 대해 여러 약물들을 구성하고 약효를 측정하고자 하였다.

갱년기 장애와 비만에 사용하는 약재로 구성된 약물은 황기, 생지황, 산수유, 맥문동, 인삼, 구기자를 1:1:1:1:1:1의 비율로 혼합하여 만들었으며 임시 명칭을 herbal prescription (HP)로 하였다. 여성호르몬의 천연 대체물질인 isoflavone을 함유하여 에스트로겐 부족에 효과가 있는 황기15), 맥문동16) 및 혈중 지질에 영향을 주어 항비만 작용을 하는 생지황17), 인삼18), 산수유19), 구기자20)를 사용하였다.

흰쥐의 난소를 제거하여 에스트로겐 결핍성 비만을 유도하였으며, 약물처리를 통하여 체중변화와 비만 관련 호르몬에 미치는 영향을 평가하였다.

재료 및 방법»»»

1. 재료

1) 사용 한약재

사용한 한약 복합제는 새로운 처방으로 구성하였으며 인삼, 황기, 생지황, 구기자, 산수유, 맥문동을 1:1:1:1:1:1의 비율로 혼합하여 만들었다. 황기(Astragali Radix)는 콩과에 속하는 다년생 초본인 황기(Astragalus membranaceus Bunge)의 뿌리를 건조한 것으로 betaine, 엽산, 콜린 등의 성분을 함유하고 있고 강심작용, 간장보호 작용 등의 약리작용이 있다21). 당귀(Angelica Radix)는 미나리과에 속하는 다년생 초본인 왜당귀(Angelica acutiloba) 또는 당귀(Angelica sinensis)의 뿌리를 건조한 것으로 ligustilide, butylidne, phthalide 등의 성분을 함유하고 있고 자궁수축 억제작용, 월경곤란증 치료, 항균 작용 등의 약리작용이 있다21). 생지황(Rehmania Radix)은 현삼과에 속하는 다년생 초본인 지황(Rehmania gluticosa)의 뿌리를 건조한 것으로 sitisterol, mannitol, rehmanin, alkaloid 등의 성분을 함유하고 있고 강심작용, 간장보호작용 등의 약리작용이 있다21). 인삼(Ginsneg Radix)은 오가피과에 속하는 다년생 초본인 인삼(Panax ginseng)의 뿌리를 건조한 것으로 진세노시드 Rb1, Rc, Rg1 등 다수의 인삼사포닌 등의 성분을 함유하고 있고 항암, 강장작용, 조혈작용, 혈압조절작용 등의 약리작용이 있다21). 산수유(Cornus fructus)는 층층나무과에 속하는 활엽수인 산수유(Cornus officinalis)의 과육을 건조한 것으로 cornin, verbenalin saponin, tannin, palmitic acid 등의 성분을 함유하고 있고 항균 및 부교감신경흥분작용 등의 약리작용이 있다21). 맥문동(Liriope rhizoma)은 백합과에 속하는 다년생초본인 맥문동(Liriope platyphylla) 또는 개맥문동(Ophiopogon Japonicus)의 괴경을 건조한 것으로 sitosterol, stigmaterol, ophioside 등의 성분을 함유하고 있고 항균 작용, 혈당강하작용 등의 약리작용이 있다21).

본 연구는 체지방 감소에 효과가 있는 새로운 약재를 찾기 위한 연구의 일환으로 황기, 당귀, 생지황, 인삼, 산수유, 맥문동의 조합추출물이 비만증을 억제하는가를 확인하였다. 추출은 증류수를 이용하여 100℃로 환류 추출하였으며, 6가지 약재 각 10 g 씩 총 60 g을 12.6%의 수율로, 최종 7.56 g의 추출물을 얻었다. 추출물을 여과한 다음 동결 건조하여 실험에 사용할 때까지 냉장고에 보관하였으며, 인삼, 황기, 생지황, 구기자, 산수유, 맥문동 복합추출물은 HP라 명명하였다.

2) 실험동물 및 사육

실험동물은 대한바이오링크(Eumseong, Korea)에서 암컷 Sprague Dawley rats를 공급받아 실험실에서 1주일간 적응시킨 후 사용하였다. 사육장은 인공조명설비에 의하여 조명시간을 오전 7:00부터 오후 7:00까지 12시간으로 조절하였으며, 실내온도는 22℃ 내외, 습도는 60% 내외로 유지하였다. 정상군 투여 사료는 고형사료(Samyang, Seoul, Korea)를 사용하였으며, 그 조성은 粗단백 21%, 粗지방 3.5%, 粗셀룰로오즈 5.0%, 무기질 8.0% 등이다. 급수는 일반 상수도를 사용하였고, 사료와 급수는 제한하지 않았다.

2. 실험방법

1) 동물 실험

(1) 에스트로겐 결핍 유도 및 약물투약

흰쥐에 ketamine (Yuhan, Seoul, Korea)을 1 mL/kg 용량으로 근육 주사하여 전신마취시킨 다음 복부 털을 제거하였다. 70% EtOH로 수술부위를 소독한 다음 1 cm 정도로 피부, 복근, 복막을 절개한 후 난소를 노출시켜 적출수술을 하고 다시 봉합하였다. 정상군은 복막 절개를 한 후 난소적출은 하지 않고 봉합하는 모의수술(sham operation)을 시행하였다.

(2) 실험군 설정 및 약물 투여

실험은 4개 군으로 나누어 시행하였다. 즉, (1) 모의수술 정상군(NC군), (2) 에스트로겐 결핍 유도 실험대조군(OC군), (3) 에스트로겐 결핍 흰쥐에 HP 추출물 200 mg/kg씩 경구 투여한 군(HPH군) (4) 에스트로겐 결핍 흰쥐에 HP 추출물 40 mg/kg씩 경구 투여한 군(HPL군)으로 나누었다. 실험에 사용한 동물은 모의수술군과 에스트로겐 결핍 흰쥐 대조군은 10마리, 대용량 및 소용량 투여군은 8마리씩으로 하였다. 투여 약물은 동결 건조한 추출을 20 mg/mL이 되도록 생리식염수에 녹인 후 1일 1회씩 6주간 투여하였다.

2) 유전자발현 실험

(1) 총 RNA 분리

흰쥐에서 취한 조직을 phosphate-buffered saline에 넣고 균질화한 다음, 1 mL TRIzol reagent (Invitrogen, Carlsbad, CA, USA)를 처리하여 총 RNA를 분리하였다. 분리한 RNA 용액에 200 μL의 chloroform:isoamylalcohol (24:1)을 넣고 강하게 섞은 후 14,000 rpm으로 원심 분리하여 상층액 500 μL를 분리하였다. 0.5 mL isopropyl alcohol을 가하여 -20℃에서 RNA를 하룻밤 침전시킨 후 1,400 rpm으로 20분간 원심 분리하였다. 상등액을 버린 후 70% 에탄올로 세척하고 자연 건조시켰다. RNase free water에서 RNA를 녹인 후 RNase-free DNase를 첨가하고 -70℃에서 저장하였다.

(2) cDNA 제조

대조군 및 시험군에서 각각 분리한 total RNA액 1 μL에 (1 μg RNA 함유)에 oligo dT (농도 100 pmol) 1 μL, RNase free water 3 μL을 넣은 후 조심스럽게 혼합한 다음 65℃에서 10분간 incubation하였다. Primer가 annealing하도록 4℃에서 약 5분간 방치한 다음 reverse transcriptase buffer, deoxynucleotide (dNTP) (각 2.5 mM), RNase inhibitor, dithiothreitol (DTT) (100 nM), reverse transcriptase (M-MLV 200 U/μL)을 첨가한 후 아주 조심스럽게 혼합하였다. 이후 42℃에서 90분간 incubation하고 95℃에서 5분간 처리한 후 사용하였다.

(3) Reverse transcription-polymerase chain reaction (RT-PCR)

분리한 RNA에 Oligo (dT) primer (Cat.No. C1101; Promega, Madison, WI, USA), reaction buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, pH 8.3) (Cat.No. M1705; Promega), 1 mM dNTP (Cat.No. U1515; Promega)와 200 unit moloney murine leukemia virus reverse transcriptase (Cat.No. M1705; Promega)를 처리한 후 역전사를 시행하여 cDNA를 합성하였다. Polymerase chain reaction (PCR)은 total volume 25 μL에 10×PCR buffer, 0.2 mM dNTPs, 2 pmole의 sense 및 antisense primer를 넣은 혼합액에 cDNA와 1.25 unit의 Taq polymerase (Cat.No. M8295; Promega)을 넣어 시행하였다. PCR 조건은 94℃ 4분, 30 cycles (94℃ [20초], 54℃ [20초], 72℃ [30초])의 72℃ 10분이었다(Perkin Elmer Inc., Waltham, MA, USA). 증폭된 PCR 산물을 2% agarose gel에 전기영동하였다. 전기영동 결과로 나온 band를 density 분석 프로그램인 Gel-Pro analyzer 3.1 (Media Cybernetics, Rockville, MD, USA)을 이용하여 RT-PCR을 구하였다. RT-PCR에 사용한 primer는 Table I에 표시하였다.

Primers.

Primer Sense (5'-3') Antisense (5'-3')
HMGCR CCATGGCTGGTAGCATAGG GTACAGCTGATGTATAAGTCTTC
NDH2 TGACAGCATCCTGGAGAC GAACTTTCCCAGCTCTGAG
DGAT1 GAATGCTGAGTCTGTCACC AGCCATCATGGCTGTGAATG
LSS CAATCCTGACTACCAGAAG CATTGTAGAGTCGCTCTTG
Prdx6 GATTCTCAGAGTGGTTGACTC AGCTCTTTGGTGAAGACTCC
FDFT1 TACCTGTCAAGGCTCCGGAAC GCATCCATCATGAGGGTAACTG
PEMT CAGCATCATCCTGCTTCTGAAC CCAAAGTAGTCACCTAGAAAGG
PGC-1α GAAGCGGGAGTCTGAAAGG GTAAATCACACGGCGCTCTT
TNF-α GCCTCTTCTCATTCCTGCTC GAGCCCATTTGGGAACTTCT
Leptin GACACCAAAACCCTCAT CAGTGTCTGGTCCATCT
PPAR-γ TCGGAGGGCTCTGTCATC CATCTGTACTGGTGGGGACA
LPL GCCCAGCAACATTATCCAGT AGCAGCATGGGCTCCAAGA

HMGCR: 3-hydroxy-3-methylglutaryl-CoA reductase, NDH2: NADH dehydrogenase2, DGAT1: diacyl glycerol acyltransferase1, LSS: lanosterol synthase, Prdx6: peroxiredoxin, FDFT1: farnesyl diphosphate farnesyltransferase1, PEMT: phosphatidylethanolamine N-methyltransferase, PGC-1α: peroxisome proliferator-activated receptor-γ coactivator-1α, TNF-α: tumor necrosis factor-α, PPAR-γ: peroxisome proliferator-activated receptor (PPAR)-γ, LPL: lipoprotein lipase..



(4) Real time RT-PCR

각각의 optical tube (MicroAmp® Optical 96-well Reaction Plate with Barcode and Optical Adhesive Films; Cat.No. 4314320; Applied Biosystems, Foster City, CA, USA)에 3배의 SybrGreen Mix 2.5 μL (Cat.No. S9430; Sigma-Aldrich, St. Louis, MO, USA), (2)에서 합성한 cDNA 1 μL, 10 pmol/μL primer pair mix 1 μL, 각각 2.5 mM의 dNTP 2 μL, 10× Tag polymerase buffer 2.5 μL, Tag polymerase 0.3 μL와 14.7 μL H2O를 넣고, 95℃ 5 min 1 cycle, 95℃ 30 sec, 45℃ 30 sec, 72℃ 60 sec 40 cycles, 95℃ 20 min 1 cycle로 증폭시켰다. Primer는 RT-PCR에 사용한 것을 이용하였다. PCR을 마친 후 tube를 꺼낸 다음, 반응액 5 μL를 사용하여 3% agarose gel에서 PCR specificity를 측정하고, ABI PRISM® 7000 Sequence Detection System (Cat.No. 4349157; Applied Biosystems)를 사용하여 real time PCR 결과를 분석하였다.

3. 통계처리

통계처리 프로그램은 SPSS-statistical software version 21.0 (SPSS Inc., Chicago, IL, USA)을 사용하였다. 각 결과는 mean±standard error of the mean으로 표시하였다. 결과에 대한 유의성 검증은 one-way analysis of variance 분석을 이용하였으며, p-value가 0.05 이하인 경우에 유의한 것으로 판단하였다.

결과»»»

1. 체중 변화

약물 투여 6주 후의 평균 체중은 NC군 277 g, OC군 371 g, HPH군 352 g, HPL군 338 g으로 측정되었다. OC군은 NC군에 비해서 유의성 있는 체중 증가를 보였으며, HPH군과 HPL군은 OC군에 비해 체중이 감소되었다(Table II).

Effect of HP on Change of Body Weight (g).

NC OC HPH HPL
0 week 225±8 226±11 226±11 229±8
2 weeks 241±16 297±17* 286±21 276±13
4 weeks 267±16 339±19* 323±22 308±17
6 weeks 277±18 371±22* 352±25 338±14

Values are presented as mean±standard error of the mean..

HP: herbal prescription, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.) for 6 weeks, HPL: OC+HP 40 mg/kg/day, P.O. for 6 weeks..

*p<0.01 vs NC group, p<0.05 vs OC group..



2. HP가 호르몬 발현에 미치는 영향

1) Leptin 발현에 미치는 영향

약물 투여 6주 후의 평균 체중은 NC군 277 g, OC군 371 g, HPH군 352 g, HPL군 338 g으로 측정되었다. OC군은 NC군에 비해서 유의성 있는 체중 증가를 보였으며, HPH군과 HPL군은 OC군에 비해 체중이 감소되었다(Table II).

Leptin은 식욕을 억제하여 체중을 조절한다22). 실험 결과 OC군에서는 NC군에 비해 leptin 발현이 억제되었으며, HPL군에서 leptin 발현이 증가하였다. 그러나 HPH군에서는 유의적인 변화가 나타나지 않았다(Fig. 1).

Fig. 1. Effect of HP on the leptin gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.01 vs NC, **p<0.05 vs OC.

2) Lipoprotein lipase (LPL) 발현에 미치는 영향

LPL은 triglycerides를 지방산과 글리세롤로 분해한다23). 실험 결과 OC군에서는 NC군에 비해 LPL 발현이 억제되었으며, HPL군에서 LPL 발현이 증가하였다(Fig. 2).

Fig. 2. Effect of HP on the LPL gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, LPL: lipoprotein lipase, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.01 vs NC, **p<0.05 vs OC.

3) Peroxisome proliferator-activated receptor (PPAR)-γ 발현에 미치는 영향

PPAR-γ는 지방조직의 생성을 촉진하고, leptin 유전자의 발현을 감소시켜 leptin에 의해 유도되는 지방분해(lipolysis)와 지방산 산화를 제한함으로써 지방생성을 촉진한다24). 실험 결과, OC군에서는 NC군에 비해 PPAR-γ 발현이 억제되었으나 HPL군과 HPH군에서는 유의성 있는 결과를 얻지 못했다(Fig. 3).

Fig. 3. Effect of HP on the PPAR-γ gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, PPAR-γ: peroxisome proliferator-activated receptor-γ, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.01 vs NC.

4) Peroxisome proliferator-activated receptor-γ coactivator (PGC)-1α 발현에 미치는 영향

PGC-1α은 근육에서 glucose transporter type 4 (GLUT4)를 활성화시키고, 지방산을 산화시키는데 중추적 역할을 한다25). OC군에서는 NC군에 비해 PGC-1α의 발현이 억제되었으며, HPL군에서 PGC-1α 발현이 증가였고, HPH군에서도 발현이 증가하였다(Fig. 4).

Fig. 4. Effect of HP on the PGC-1α gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, PGC-1α: peroxisome proliferator-activated receptor-γ coactivator-1α, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.01 vs NC, **p<0.01 vs OC, #p<0.05 vs OC.

5) 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) 발현에 미치는 영향

HMGCR은 콜레스테롤 합성에 관여한다26). OC군에서는 NC군에 비해 HMGCR 발현이 증가되었으며, 약물투여에 의한 유의성 있는 결과는 얻지 못했다(Fig. 5).

Fig. 5. Effect of HP on the HMGCR gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, HMGCR: 3-hydroxy-3-methylglutaryl-CoA reductase, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.05 vs NC.

6) NADH dehydrogenase (NDH) 발현에 미치는 영향

NDH는 지방산을 저장형 지방으로 전환되는데 필요한 에너지를 공급한다27). OC군에서는 NC군에 비해 NDH 발현이 억제되었으며, HPL군과 HPH군에서 NDH 발현이 증가하였다(Fig. 6).

Fig. 6. Effect of HP on the NDH gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, NDH: NADH dehydrogenase, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.05 vs NC, **p<0.01 vs OC.

7) Diacyl glycerol acyltransferase (DGAT)1 발현에 미치는 영향

DGAT1는 세포내에서 triglyceride (TG) 합성의 주요 경로인 glycerol phosphate pathway와 소장의 장세포 monoacylglycerol pathway의 마지막 단계인 diacylglycerol와 acyl CoA의 합성과정에 영향을 미친다28,29). OC군에서는 NC군에 비해 DGAT1 발현이 억제되었으며, HPL군과 HPH군에서 DGAT1 발현이 증가하였다(Fig. 7).

Fig. 7. Effect of HP on the DGAT1 gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, DGAT1: diacyl glycerol acyltransferase1, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.05 vs NC, **p<0.01 vs OC, #p<0.05 vs OC.

8) Farnesyl diphosphate farnesyltransferase (FDFT)1 발현에 미치는 영향

FDFT1는 콜레스테롤 생성에 관여한다. 실험 결과 HP는 FDFT1의 발현을 억제시켰다30). OC군에서는 NC군에 비해 FDFT1 발현이 억제되었으며, HPL군과 HPH군에서 FDFT1 발현이 증가하였다(Fig. 8).

Fig. 8. Effect of HP on the FDFT1 gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, FDFT1: farnesyl diphosphate farnesyltransferase1, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.01 vs NC, **p<0.01 vs OC, #p<0.05 vs OC.

9) Lanosterol synthase (LSS) 발현에 미치는 영향

Lanosterol은 콜레스테롤의 전구물질로서 LSS는 콜레스테롤의 생성에 관여한다31). OC군에서는 NC군에 비해 LSS 발현이 억제되었으며, HPL군과 HPH군에서 LSS 발현이 증가하였다(Fig. 9).

Fig. 9. Effect of HP on the LSS gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, LSS: Lanosterol synthase, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.05 vs NC, **p<0.05 vs OC.

10) Phosphatidylethanolamine N-methyltransferase (PEMT) 발현에 미치는 영향

PEMT는 phosphatidylcholine의 생성에 촉매 작용을 해서 지방을 감소시킨다32). OC군에서는 NC군에 비해 PEMT 발현이 억제되었으며, HPL군과 HPH군에서 PEMT 발현이 증가하였다(Fig. 10).

Fig. 10. Effect of HP on the PEMT gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, PEMT: phosphatidylethanolamine N-methyltransferase, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.05 vs NC, **p<0.01 vs OC.

11) Tumor necrosis factor (TNF)-α 발현에 미치는 영향

TNF-α는 비만에서 인슐린 저항성과 관련되어 있다. 지방세포에 중성지질이 축적되면 TNF-α가 다량 배출된다33). 실험에서 유의성 있는 TNF-α 발현의 결과를 얻지 못했다(Fig. 11).

Fig. 11. Effect of HP on the TNFa gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, TNF-α: tumor necrosis factor-α, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O..

12) Peroxiredoxin (Prdx6) 발현에 미치는 영향

Prdx6은 체내에서 지방산을 감소시킨다34). OC군에서는 NC군에 비해 Prdx6 발현이 억제되었으나 유의성이 있는 수준까지 억제되지는 않았다. HPH군과 HPL군에서는 Prdx6 발현이 증가되었다(Fig. 12).

Fig. 12. Effect of HP on the Prdx6 gene expression in muscle of estrogen-deficient rat. HP: herbal prescription, Prdx6: peroxiredoxin, NC: normal control, OC: ovariectomized control, HPH: OC+HP 200 mg/kg/day, par os (P.O.), HPL: OC+HP 40 mg/kg/day, P.O.. *p<0.05 vs OC.
고찰»»»

비만은 대부분 연령이 높아지면서 발생이 증가하는데, 이는 연령이 높아지면서 에너지 소모 감소와 성호르몬 감소로 근육의 단백질 합성 감소, 지방세포에서 지방 축적의 촉진 결과로 나타난다고 보고되었다35). 특히 여성 폐경기 이후에 나타나는 비만은 에스트로겐이 결핍되어 나타난다. 에스트로겐은 직접적으로 지방세포의 분화를 억제하고 각종 adipokine을 조절함으로서 체중뿐만 아니라 비만으로 인한 각종 합병증을 억제할 수 있다. 에스트로겐이 혈관내피세포에서 interleukin-1이 유도하는 vascular cell adhesion molecule-1, E-selectin 및 intercellular adhesion molecule-1의 과다발현을 억제하고36) 단핵세포가 혈관내피세포에 붙는 것을 억제하는 동시에37) high density lipoprotein과 반응하여 콜레스테롤을 에스테르화시키고 low density lipoprotein의 생성을 억제하여38) 거품세포 생성을 억제하여 동맥경화 발생을 줄일 수 있다39). 또한 에스트로겐은 직접적으로 혈관 평활근을 자극함으로써 관상동맥에서 Ca2+와 K+ channel에 작용하고 혈관 내피세포에서 nitric oxide 등을 분비하게 하여 혈관을 확장시켜 혈압을 떨어뜨린다40). 이러한 작용은 임신 중에 혈류, 맥박, 박출량이 증가함에도 불구하고 에스트로겐의 혈관 평활근 이완작용으로 임신 마지막 몇 주 전까지 낮게 유지시키며 대퇴동맥, 관상동맥, 뇌동맥에서 혈관이완효과를 나타낸다고 보고되었다.

또한 에스트로겐은 직접적으로 지방합성을 억제하고 지방산 분해를 촉진하여 지방 세포 내에 지방이 축적되는 것을 억제한다. 이러한 작용은 주로 지방세포로 지방을 축적시키는 효소인 LPL의 작용을 줄임으로써 일어난다. 폐경 후 여성뿐 아니라 동물실험에 있어서 난소를 적출하면 LPL이 늘어나서 지방세포 내 지방이 축적되고, 음식섭취가 촉진되어 몸무게가 증가되는데 에스트로겐의 활성형인 에스트라디올을 투여하게 되면 이러한 지방축적이 줄어든다. 에스트라디올은 지방을 분해하는 hormone-sensitive lipase를 유도하거나 epinephrine의 지방 분해 효과를 증대시킴으로 지방을 분해한다. 또한 지방산 β 산화(fatty acid-β oxidation)가 일어남으로 지방조직의 축적을 감소시킨다. 이러한 지방합성을 억제하고 지방을 분해하는 작용과는 반대로 사람의 피하지방세포에서 에스트로겐은 아드레날린의 α2A 수용체를 조절하여 지방분해를 감소시킨다. 이는 여성이 남성에 비해 피하지방이 축적되는 이유를 설명해주기도 한다. 또한 estrogen receptor가 발현되는 bone marrow stromal cell line에 estrogen을 처리하면 지방세포 분화를 억제하고41) 시상하부에 작용함으로써 음식섭취를 감소시키고 활동량을 증가시켜 에너지 소비를 증가시키는 효과를 나타내며42) 간에서 지질 대사와 관련되어 콜레스테롤 흡수를 억제한다.

본 연구에서는 HP가 에스트로겐이 결핍된 흰쥐에서 체중 및 근육에서의 유전자 발현에 미치는 영향을 측정하여 비만 및 심혈관계 질환의 주요한 합병증으로 발병하는 고지혈증에서의 HP의 응용가능성을 평가하고자 하였다. 우선 에스트로겐 결핍상태에서 증가하는 체중에 대한 HP의 영향을 측정한 결과 HP 투여 6주 후 OC군은 NC군에 비해서 유의성 있는 체중 증가를 보였으며, HPH군과 HPL군은 OC군에 비해 체중이 감소되었다. 이를 바탕으로 에스트로겐 결핍 상태의 근육에서 유전자 발현을 측정하고 HP의 영향을 평가하고자 하였다.

Leptin은 에너지 균형조절의 주요인자로 1994년에 발견된 ob 유전자 발현으로 나타나는 단백질이며 체지방량 정보를 뇌에 전달하여 식습관과 대사, 내분비기능 등을 조절하고 acetyl-CoA carboxylase의 유전자 발현, 지방산 합성, 지질 합성을 억제하고 지방분해를 촉진한다30). 또한 시상하부의 렙틴 수용체(Ob-Rβ)는 에스트로겐의 상태에 따라 조절된다. 에스트로겐이 결핍된 경우 leptin 수용체가 감소되고 이것은 난소절제 후 혈청 렙틴이 증가함에도 불구하고 에스트로겐의 감소 이후에 비만이 유발되는 원인으로 알려졌다43). 실험 결과, 저농도 HP는 에스트로겐이 결핍된 흰쥐의 근육에서 leptin 발현을 증가시켰다.

LPL은 혈관의 중성지방을 분해하여 지방세포 속으로 흡수한다. 이 LPL은 인슐린에 의해 작용이 활성화되는 효소이므로 고인슐린혈증이 동반된 비만증에서는 LPL의 활성도가 더욱 높아진다. LPL의 활성이 증가되면 중성지방의 지방 세포로의 흡수가 왕성해져 더욱 비만해진다. LPL은 근육에서는 지단백의 형태로 온 지방을 지방산과 글리세롤로 분해시켜 유리지방산을 에너지원으로 사용하게 한다. 실험 결과, 저농도 HP는 에스트로겐이 결핍된 흰쥐의 근육에서 LPL 발현을 증가시켰다.

DGAT1는 세포 내 주요 TG 합성의 주요 경로인 glycerol phosphate pathway와 소장의 장세포의 monoacylglycerol pathway의 마지막 단계인 diacylglycerol와 acyl CoA의 합성과정을 촉매하여 TG를 생산한다27). 실험 결과 HP는 근육세포에서 DGAT1의 발현을 증가시켰다. 그러나 DGAT1 억제제가 비만치료에 응용되고 있음을 볼 때, 근육에서의 DGAT1 발현 원인에 대해 추가적인 연구가 필요할 것으로 판단된다.

TNF-α는 비만에서 인슐린 저항성과 관련되어 있다. TNF-α는 인슐린에 민감한 포도당 수용체4 (GLUT4)와 인슐린 수용체 기질-1 (insulin receptor substrate 1, IRS-1)의 발현을 감소시키고 IRS-1 및 다른 인슐린에 특이성을 가진 수용체의 세린인산화를 증가시켜 인슐린 신호를 방해한다44). 실험 결과, 에스트로겐이 결핍된 흰쥐의 근육에서 TNF-α 발현은 대조군에 비해 감소하였으나, HP 투여 시 TNF-α 발현에는 영향이 없었다.

PPARs는 지방세포의 분화와 대사에서 중요한 역할을 하는 nuclear hormone receptor superfamily에 속한다. PPAR family member로는 PPARα, PPARγ와 PPARδ가 있으며 이들 PPAR 전사인자들은 retinoid X receptor α와 heterodimer을 이루어 표적 유전자의 promotor 또는 enhancer에 존재하는 peroxisome proliferator response element를 인지하고 표적 유전자의 발현을 조절해 나간다15). PPAR-γ는 비만 동물의 대사를 변화시켜 비만을 증가시킨다. 또한 골격근과 지방조직에서 지방산 흡수를 증가시키고 β-oxidation과 같은 지방산 분해도 촉진하는 것으로 알려져 있다. 이와 함께 PGC-1α는 PPARγ의 co-activator로 작용한다고 보고되었다45). 따라서 체내 지방 축적을 촉진하는 PPAR-γ 작용을 촉진한다. 실험 결과, HP는 에스트로겐이 결핍된 흰쥐의 근육에서 PPAR-γ 발현은 감소하였으나, HP 투여 시 별다른 영향을 미치지 못했다.

HMGCR는 콜레스테롤을 합성하는 과정에서 HMG CoA를 mevalonate로 변환시키는 효소로 콜레스테롤 합성뿐만 아니라 정상 세포 기능에 필수적인 nonsterol isoprenoids를 생성하는 과정의 반응 결정 단계에 해당하는 효소이다46). 이 효소를 억제하는 경우 콜레스테롤 합성이 억제될 수 있다고 보고되었으며, HMGCR 활성을 억제하여 고콜레스테롤증을 치료하는 약물들이 개발되었다37). 실험 결과, 에스트로겐이 결핍된 흰쥐의 근육에서 HMGCR 발현이 증가하였으나, HP는 근육의 HMGCR 발현에 영향을 주지 못했다.

이상의 결과, HP는 에스트로겐이 결핍된 흰쥐에서 증가하는 체중을 감소시켰으며, 지질대사에 관여하는 근육세포의 유전자 발현에 영향을 미쳐 비만 관련 호르몬을 조절하는 것으로 판단되었다. 따라서 인삼, 황기, 생지황, 구기자, 산수유, 맥문동으로 구성된 HP는 에스트로겐 결핍으로 인한 비만과 합병증에 응용될 수 있을 것으로 판단되며 향후 단미제 뿐만 아니라 복합제제 등의 연구에 참고가 될 수 있을 것으로 생각된다. 그러나 각 약재들에 대한 에스트로겐 결핍성 비만에 대한 단독 실험이 진행되지 않았다는 점과 각 약재의 처방 구성을 임의로 1:1:1:1:1:1로 하였다는 점, 반복 실험의 부재 등 많은 부분에 한계가 있는 연구이며 추후 정밀한 실험 설계 및 발전된 연구가 필요할 것으로 생각된다.

결론»»»

HP (인삼, 황기, 생지황, 구기자, 산수유, 맥문동 복합추출물)가 에스트로겐 결핍성 질환에 미치는 영향을 평가하기 위하여 흰쥐의 난소를 제거하여 에스트로겐 결핍성 비만을 유도하였으며, 약물처리를 통하여 체중변화와 비만 관련 호르몬에 미치는 영향을 평가하였다.

  • HP는 에스트로겐이 결핍된 흰쥐의 근육에서 PPAR-γ, TNF-α, HMGCR 발현 조절에 유의한 영향을 미치지 못했다.

  • HP는 에스트로겐이 결핍된 흰쥐의 근육에서 leptin, LPL, DGAT1, PGC-1α, NDH, FDFT1, LSS, PEMT, Prdx6 발현 증가에 유의한 영향을 미쳤다.

이상의 결과를 종합하면, HP는 비만 조절 호르몬인 leptin, LPL, DGAT1, PGC-1α, NDH, FDFT1, LSS, PEMT, Prdx6 발현을 증가시키는데 유의한 결과를 보였으며 이는 체내 지방대사에 직간접적인 영향을 주어 에스트로겐 결핍으로 인해 발생하는 갱년기 비만과 비만 합병증을 개선하는 효과를 나타낼 수 있을 것으로 판단하였다. 다만 PPAR-γ, TNF-α, HMGCR의 발현에 영향을 미치지 못하였으며 특히 인슐린 조절과 관련있는 TNF-α 및 콜레스테롤 합성에 영향을 주는 HMGCR의 발현에 유의성이 없어 비만과 관련된 대사질환에는 유의미한 효과가 없을 것으로 생각된다.

References
  1. Park HS, Kim MY, Lee SW, Shin ES. Diet and eating behavior in obese patients. Kor J Fam Med. 1994;15(6):353-61.
  2. Dawood MY. Hormone replacement therapy, current regimens. The female patient. Obstetrics & Gynecology. 1992;2:5-18.
  3. Bush TL, Miller TV. Effect of pharmacologic agents used during menopause. Menopause physiology and pharmacology. Chicago:Year Book Medical Publisher. 1987:185-205.
  4. Kim KJ, Lee WJ, Lee SJ, Ahn NY, Oh HR, Shin YJ, Park JS. Health status and lifestyle including diet, exercise, and daily activities in obese adults. J Kor Sports Med. 2005;23(1):54-63.
  5. Garfinkel L. Overweight and cancer. Ann Intern Med. 1985;103:1034-6.
    Pubmed CrossRef
  6. Lee HG. Obesity related diseases. J Nutr Health. 1990;23(5):341-6.
  7. Cooke PS, Naaz A. Role of estrogens in adipocyte development and function. Experimental Biology and Medicine. 2004;229(11):1127-35.
    Pubmed CrossRef
  8. Yeo E. Menopause, aging and obesity. Kor J Obes. 2002;11(3):289-98.
  9. Yang YG. Naegyeongsomun-yeakhae. Seoul:Daesung Print. 1990:235-43, 356-61.
  10. Kim JM, Choi SM, Yang DH, An HD. The effect of oral administration at herbal medicines in animal models on obesity: a review of animal study reports published in Korea after 2010. J Korean Med Rehabil. 2017;27(3):13-32.
    CrossRef
  11. Shin HJ, Yoo JE, Jung EH, Yoo DY. Effects of Pueraria lobata on body weight and gene expression in obese rats muscle with estrogen deficiency. J Korean Obstet Gynecol. 2012;25(3):71-84.
  12. Shin YS, Hwang GS. The effects of Pueraria lobata extract on gene expression in liver tissue of rat with estrogen-deficient obesity. J Korean Prevent Med. 2014;18(3):117-28.
  13. Baek SE, Baek JY, Kang KS, Yoo JE. Effects of Pueraria lobata on obesity related hormones in rats with estrogen deficiency. J Korean Med Obes Res. 2017;17(2):111-8.
    CrossRef
  14. Lee HI, Yoo DY, Yo JE. Effects of Hwanggimacmundong-tang on body weight and gene expression in obese rats with estrogen deficiency. J Korean Obstet Gynecol. 2018;31(2):49-67.
  15. Im KR, Kim MJ, Jung TK, Yoon KS. Analysis of isoflavonoid contents in astragalus membranaceus bunge cultivated in different areas and at various ages. KSBB Journal. 2010;25:271-6.
  16. Zhang XH, Liu SX, Xu M. The research of phytoestrogen and chinese herb. Tradit Chin Drug Res Clin Pharmacol. 2002;13(4):261-4.
  17. Calpe-Berdiel L, Escola-Gil JC, Blanco-Vaca F. New insights into the molecular actions of plant sterols and stanols in cholesterol metabolism. Atherosclerosis. 2009;203:18-31.
    Pubmed CrossRef
  18. Oh YJ, Kwon SH, Choi KB, Kim TS, Yeo IH. Effect of vinegar made with hydroponic-cultured panax ginseng C. A. Meyer on body weight and lipid metabolism in high-fat diet-fed mice. J Korean Food Sci and Tech. 2014;46(6):743-9.
    CrossRef
  19. Shin JH, Lee JH, Kang KW, Hwang JH. Selection and mechanism of anti-obesity agents from natural products based on anti-angiogenesis. KSBB Journal. 2009;24:122-30.
  20. Kim MH. Effect of Lycii fructus extracts on serum lipids and bone collagen contents in ovariectomized rats. J Physiology & Pathology in Korean Med. 2007;21(1):111-6.
  21. Jeong BS, Shin MK. Traditional medicine encyclopedia. Seoul:Yoenglim Print. 1998:177-8, 407-8, 440-3, 448-9, 663-4, 906-8.
  22. Li MD. Leptin and beyond: an odyssey to the central control of body weight. Yale J Biol Med. 2011;84(1):1-7.
    Pubmed KoreaMed
  23. Wang LN, Yu Q, Xiong Y, Liu LF, Zhang Z, Zhang XN, Cheng H, Wang B. Lipoprotein lipase gene polymorphisms and risks of childhood obesity in Chinese preschool children. Eur J Pediatr. 2011;170(10):1309-16.
    Pubmed CrossRef
  24. Nakagami H, Morishita R. Obesity and gastrointestinal hormones-dual effect of angiotensin II receptor blockade and a partial agonist of PPAR-γ. Curr Vasc Pharmacol. 2011;9(2):162-6.
    Pubmed CrossRef
  25. Dominy JE Jr Jr Jr, Lee Y, Gerhart-Hines Z, Puigserver P. Nutrient-dependent regulation of PGC-1alpha's acetylation state and metabolic function through the enzymatic activities of Sirt1/GCN5. Biochim Biophys Acta. 2010;1804(8):1676-83.
    Pubmed KoreaMed CrossRef
  26. Chan MY, Zhao Y, Heng CK. Sequential responses to high-fat and high-calorie feeding in an obese mouse model. Obesity (Silver Spring). 2008;16(5):972-8.
    Pubmed CrossRef
  27. Yamamoto T, Habata Y, Matsumoto Y, Yasuhara Y, Hashimoto T, Hamajyo H, Anayama H, Fujii R, Fuse H, Shintani Y, Mori M. Apelin-transgenic mice exhibit a resistance against diet-induced obesity by increasing vascular mass and mitochondrial biogenesis in skeletal muscle. Biochim Biophys Acta. 2011;1810(9):853-62.
    Pubmed CrossRef
  28. Yamamoto T, Yamaguchi H, Miki H, Kitamura S, Nakada Y, Aicher TD, Pratt SA, Kato K. A novel coenzyme A: diacylglycerol acyltransferase 1 inhibitor stimulates lipid metabolism in muscle and lowers weight in animal models of obesity. Eur J Pharmacol. 2011;650(2-3):663-72.
    Pubmed CrossRef
  29. Birch AM, Buckett LK, Turnbull AV. DGAT1 inhibitors as anti-obesity and anti-diabetic agents. Curr Opin Drug Discov Devel. 2010;13(4):489-96.
    Pubmed
  30. Andreasen CH, Mogensen MS, Borch-Johnsen K, Sandbaek A, Lauritzen T, Almind K, Hansen L, Jørgensen T, Pedersen O, Hansen T. Studies of CTNNBL1 and FDFT1 variants and measures of obesity: analyses of quantitative traits and case-control studies in 18,014 Danes. BMC Med Genet. 2009;10:1-9.
    Pubmed KoreaMed CrossRef
  31. Brannian J, Eyster K, Greenway M, Henriksen C, Teslaa K, Diggins M. Progressive obesity leads to altered ovarian gene expression in the Lethal yellow mouse: a microarray study. J Ovarian Res. 2009;10:1-9.
    Pubmed KoreaMed CrossRef
  32. Fu S, Yang L, Li P, Hofmann O, Dicker L, Hide W, Lin X, Watkins SM, Ivanov AR, Hotamisligil GS. Aberrant lipid metabolism disrupts calcium homeostasis causing liver endoplasmic reticulum stress in obesity. Nature. 2011;473(7348):528-31.
    Pubmed KoreaMed CrossRef
  33. Hirokawa J, Sakaue S, Tagami S, Kawakami Y, Sakai M, Nishi S, Nishihira J. Identification of macrophage migration inhibitory factor in adipose tissue and its induction by tumor necrosis factor-α. Biochem Biophys Res Commun. 1997;235(1):94-8.
    Pubmed CrossRef
  34. Zhang W, Ambati S, Della-Fera MA, Choi YH, Baile CA, Andacht TM. Leptin modulated changes in adipose tissue protein expression in ob/ob mice. Obesity (Silver Spring). 2011;19(2):255-61.
    Pubmed CrossRef
  35. White RE, Darkow DJ, Lang JL. Estrogen relaxes coronary arteries by opening BKCa channels through a cGMP-dependent mechanism. Circ Res. 1995;77(5):936-42.
    Pubmed CrossRef
  36. Wellman GC, Bonev AD, Nelson MT, Brayden JE. Gender differences in coronary artery diameter involve estrogen, nitric oxide, and Ca2+-dependent K+ channels. Circ Res. 1996;79(5):1024-30.
    Pubmed CrossRef
  37. Geary GG, Krause DN, Duckles SP. Estrogen reduces mouse cerebral artery tone through endothelial NOS- and cyclooxygenase dependent mechanisms. Am J Physiol Heart Circ Physiol. 2000;279(2):511-9.
    Pubmed CrossRef
  38. Geary N, Asarian L. Estradiol increases glucagon's satiating potency in ovariectomized rats. Am J Physiol Heart Circ Physiol. 2000;279(2):511-9.
    Pubmed CrossRef
  39. Palin SL, McTernan PG, Anderson LA, Sturdee DW, Barnett AH, Kumar S. 17Beta-estradiol and anti-estrogen ICI: compound 182, 780 regulate expression of lipoprotein lipase and hormone-sensitive lipase in isolated subcutaneous abdominal adipocytes. Metabolism. 2003;52(4):383-8.
    Pubmed CrossRef
  40. Misso ML, Murata Y, Boon WC, Jones ME, Britt KL, Simpson ER. Cellular and molecular characterization of the adipose phenotype of the aromatase-deficient mouse. Endocrinology. 2003;144(4):1474-80.
    Pubmed CrossRef
  41. Ramsay TG. Fat cells. Endocrinol Metab Clin North Am. 1996;25(4):847-9.
    CrossRef
  42. Kopelman PG. Effects of obesity on fat topography: metabolic and endocrine determinants. In: Kopelman PG, Stock MJeds. Clinical obesity. 1st ed. Oxford:Blackwell Science. 1998:158-75.
  43. Pedersen SB, Kristensen K, Hermann PA, Katzenellenbogen JA, Richelsen B. Estrogen controls lipolysis by up-regulating alpha2A adrenergic receptors directly in human adipose tissue through the estrogen receptor alpha. Implications for the female fat distribution. J Clin Endocrinol Metab. 2004;89(4):1869-78.
    Pubmed CrossRef
  44. Jensen MD. Lipolysis: contribution from regional fat. Annu Rev Nutr. 1997;17:127-39.
    Pubmed CrossRef
  45. Matsuzawa Y, Funahashi T, Kihara S, Shimomura I. Adiponectin and metabolic syndrome. Arterioscler Thromb Vasc Biol. 2004;24:29-33.
    Pubmed CrossRef
  46. Valdez CM, Phelix CF, Smith MA, Perry G, Santamaria F. Modeling cholesterol metabolism by gene expression profiling in the hippocampus. Mol Biosyst. 2011;7(6):1891-901.
    Pubmed KoreaMed CrossRef


January 2020, 30 (1)

Cited By Articles
  • CrossRef (0)

  • Crossref TDM
  • CrossMark
  • orcid