search for




 

J Korean Med Rehabi 2021 Jan; 31(1): 47-57  https://doi.org/10.18325/jkmr.2021.31.1.47
A Study of Antimicrobial Activity of Herbal Extracts on Clostridium difficile
Published online January 31, 2021
Copyright © 2021 The Society of Korean Medicine Rehabilitation.

Eunhak Seong, K.M.D., Sookyoung Lim, M.S., Myeongjong Lee, K.M.D., Hojun Kim, K.M.D.

Department of Rehabilitation Medicine of Korean Medicine, College of Korean Medicine, Dongguk University
Correspondence to: Hojun Kim, Department of Rehabilitation Medicine of Korean Medicine, Dongguk University Ilsan Oriental Hospital, College of Korean Medicine, Dongguk University, 27 Dongguk-ro, Ilsandong-gu, Goyang 10326, Korea
TEL (031) 961-9111
FAX (031) 961-9009
E-mail kimklar@dongguk.ac.kr
Received: October 29, 2020; Revised: November 5, 2020; Accepted: November 11, 2020
Abstract
Objectives This study was conducted to confirm the possibility of Clostridium difficile infection (CDI) treatment through natural herbal medicines.
Methods After screening a total of 77 herbal medicines through the paper disc agar diffusion method, we selected the herbal medicines that showed a effectiveness compared to the positive control vancomycin. Afterwards, drugs that showed inhibitory effects compared to C. difficile without inhibition of Bifidobacterium bifidum and Lactobacillus plantarum, known as beneficial bacteria, were selected and minimal inhibitory concentration (MIC) was confirmed by applying the Broth microdilution method.
Results The Coptidis Rhizoma, well known for its antimicrobial effect, was found to have antimicrobial effects on C. difficile, but also had inhibitory effects on the beneficial bacterium B. bifidum. 30% ethanol extraction Crataegi fructus, Corni fructus and Mume fructus had antimicrobial effects on C. difficile without inhibiting the beneficial bacteria B. bifidum and L. plantarum. The MIC values of 30% ethanol extraction Crataegi fructus, Corni fructus and Mume fructus were found to be 10 mg/mL, 20 mg/mL and 5 mg/mL, respectively.
Conclusions Crataegi fructus, Corni fructus and Mume fructus were identified as candidate medicines for C. difficile. Further researchs will need to be done in vivo, and to find an optimal extraction method accompanied by economic evaluation.
Keywords : Clostridioides difficile, Anti-Microbial Agent, Korean Traditional Medicine
서론»»»

그람양성, 포자생성, 편성 혐기성균인 Clostridium difficile은 숙주의 장내 미생물 환경이 붕괴되면 급격히 증가하여 경증의 설사부터 위막성 대장염까지 다양한 소화기관련 문제를 일으킨다1). Clostridium difficile infection (CDI) 위험은 항생제 치료, 위장관 수술, 프로톤펌프저해제 등에 의해 증가하는데2), 한방재활의학과에 입원하는 뇌졸중 혹은 척수손상 환자군의 경우 급성기에 항생제 등의 치료를 받은 후 전원오는 경우가 많아 지속적으로 설사하는 환자는 CDI를 고려할 필요가 있다. 또한 원내 전파에 의한 CDI는 병원성 설사의 흔한 원인이 되며 구획을 나누기 어렵고, 의료 장비들을 공동 사용하는 재활치료 환자들의 특성상 감염 위험에 더욱 취약하다고 볼 수 있다3,4). 국내의 경우 CDI 유병률이 2008년 10만명당 1.43명에서 2011년 10만명당 5.06명으로 가파르게 늘고 있는 추세이며 이와 더불어 경제적 부담 또한 2008년 240만 달러에서 2011년 1,580만 달러로 크게 증가하는 경향을 보이고 있다5). 재활치료를 위해 입원한 환자를 대상으로 한 이전 연구에서는 CDI 환자의 재활 기간이 늘어났으며, 재활치료 시행 결과가 비감염군에 비해 효과적이지 못했다고 보고하였다6).

CDI에 대한 치료로는 metronidazole, vancomycin, fidaxomicin 등의 항생제 요법, 대변 세균총 이식(fecal microbial transplantation, FMT) 등이 고려되고 있다7). 하지만 항생제와 관련한 새로운 타입의 내성 균주 출현과 C. difficile에 대한 재감염의 위험이 존재한다8). FMT의 경우 공여자와 대상자의 선택, 주입 경로 등 표준화된 프로토콜의 부재, 안정성 등이 해결되어야 할 문제로 제시되고 있다9).

CDI에 대한 천연약물치료 관련 연구로 한의학적 원리의 복방으로 삼령백출산, QPYF 등이, 단일 약물로는 황련추출물인 황련수, 흑종초, 몰약, 마누카 꿀, 버진 코코넛 오일, 석류추출물, 당귀, 홉 등이 있었으나 임상적으로 다용되는 한약재 관련 연구는 아직 부족한 실정이다10-16). 이에 천연 한약재를 통한 CDI 치료의 가능성을 확인하고자 본 연구를 시행하였다.

재료 및 방법»»»

1. 실험재료

1) 생약 추출물 및 한약재

77종의 생약 추출물은 한국식물추출물은행(Cheongju, Korea)에서 분양받았다. 식물 추출물의 항균성은 일반적으로 에탄올 추출물이 증류수 추출물보다 증식억제 효과가 높다는 점을 참고하여 95.0% 에탄올로 추출한 약물을 우선 구입하되 증류수로 추출한 약물이 분양 가능한 경우 함께 구비하였다17-19). 후보 한약재로 선정된 산사, 산수유, 오매, 황련은 동국대학교 일산한방병원에서 구입 후 사용하였다.

2) 실험 균주 및 배지

실험에 사용된 균주는 생물자원센터(Jeongeup, Korea)에서 분양받은 C. difficile KCTC 5009, Bacteroides fragilis KCTC 3688, 쎌바이오텍(Kimpo, Korea)에서 분양받은 Lactobacillus plantarum, Bifidobacterium bifidum을 이용하였다. 생육배지로 C. difficile, Bacteroides fragilis은 reinforced clostridial medium agar (RCM agar; BD Difco 218081)을, B. bifidum은 MRS-cysteine (MRS supplemented with cysteine 0.5 g/L) agar (1.5%)을, L. plantarum은 MRS agar (1.5%)을 이용하여 배양하였다.

2. 방법

1) Paper disc agar diffusion method

Vancomycin 및 한약재의 항균 활성은 paper disc agar diffusion method을 이용하여 확인하였다. Vancomycin의 경우 CDI에 metronidazole과 함께 가장 많이 사용되는 항생제로 양성대조군으로 설정하였다20). C. difficile의 경우 105 CFU/mL로, Bacteroides fragilis, L. plantarum, B. bifidum의 경우 2×109 CFU/mL로 각각의 멸균된 agar 배지에 2~3%를 접종하였다. 이후 농도 2.5 mg/mL, 1.25 mg/mL, 0.63 mg/mL, 0.32 mg/mL, 0.16 mg/mL, 0.08 mg/mL, 0.04 mg/mL의 vancomycin과 10 mg/mL의 약물추출물을 30 μL씩 분주하여 37°C에서 24시간동안 배양한 후 생육저지환을 확인하였다. 약물추출용액을 만들기 위하여 20 mg의 약물 추출물을 18 μL dimethyl sulfoxide (DMSO)와 42 μL phosphate buffered saline (PBS)를 추가하여 용해시켰다. 약물을 녹인 용매에 대한 영향을 알아보기 위한 대조군으로 30% DMSO를 사용하였다.

2) 최종 후보 약물의 30% 에탄올 추출

동국대학교 일산한방병원에서 구입한 산사, 산수유, 오매, 황련 각 4 g을 분쇄하여 10배량의 30% 에탄올을 첨가한 후 60°C water bath에서 sonication하였다. 이후 3,000 rpm에서 1시간가량 원심분리하는 과정을 3회 반복한 후 상층액을 회수하고, 40°C에서 농축하여 3일간 동결건조시켰다.

3) C. difficile 검출

(1) Genomic DNA 추출

RCM agar plate에서 배양된 C. difficile, Bacteroides fragilis와 MRS agar plate에서 배양된 L. plantarum, B. bifidum colony 1개를 각각의 배양액 5 mL에 접종한 후 37°C에서 24시간동안 배양하였다. 각 미생물 배양액 2 mL을 원심분리하고 상층액은 제거한 후 분리한 균주의 pellet에서 QIAamp fast DNA stool mini kit (51604; QIAGEN, Hilden, Germany)을 이용하여 제조사의 지침에 따라 genomic DNA를 추출하였다.

(2) Polymerase chain reaction (PCR)

PCR 및 primer는 C. difficile에서 기원한 toxin A와 toxin B를 확인하는 방법을 이용한 이전 연구를 참고하였으며21), PCR에 사용된 primer들은 Table I에 나타내었다. PCR은 template genomic DNA 1 μL (50 ng), primer는 forward와 reverse 각각 1 μL (10 pmole), distilled water 17 μL를 섞어 reaction volume 20 μL로 수행하였다. PCR에 사용한 kit는 AccuPower PCR PreMix kit (K-2016; Bioneer, Daejeon, Korea)로 제조사의 지침에 따라 PCR을 수행하였다. PCR 산물은 1.5% agarose gel에 분리하여 100 V에서 3분, 50 V에서 2분 전기영동한 후 UV illumination (LAS-3000; Fuji Photo Film, Tokyo, Japan)을 사용하여 밴드를 확인하였다.

Table Ⅰ. Sequences of the Nested Polymerase Chain Reaction Primers.

Division Primer Sequence (5'-3')
Toxin A CD TcdA (NK 1)-F GGACATGGTAAAGATGAATTC
CD TcdA (NK 2)-R CCCAATAGAAGATTCAATATTAAGCTT
Toxin B CD TcdB 3-R GCTTCT TCA ATC CTT TCC TC
CD TcdB 1-F GTGGCCCTGAAGCATATG
CD TcdB 2-R TCC TCT CTC TGA ACT TCT TGC


4) 최소저해농도(minimal inhibitory concentration, MIC) 측정

최종 후보 약물의 MIC 측정을 위해 Broth microdilution method를 응용하였다22). 먼저 C. difficile은 5 mL RCM 배지에서 18~24시간 배양하고, 650 nm의 흡광도가 0.3이 되게 배양액을 맞춘 후 96 well plate에 100 μL씩 분주하였다. 약물의 농도는 20 mg/mL를 시작으로 하여 serial dilution으로 2배씩 희석하여 10 mg/mL, 5 mg/mL, 2.5 mg/mL, 1.25 mg/mL, 0.63 mg/mL, 0.32 mg/mL, 0.16 mg/mL, 0.08 mg/mL, 0.04 mg/mL 농도까지 희석한 후 100 μL씩 분주하였다. 이후 24시간 배양한 후 C. difficile의 증식에 미치는 영향을 650 nm에서 ELISA reader을 이용하여 측정하였다.

결과»»»

1. C. difficile 대비 항균 효과

본 연구를 위하여 C. difficile 대비 항균 효과를 보일 것으로 예상되는 후보 약물 77종을 선정하였다(Table II). 양성대조군으로 선정된 vancomycin의 C. difficile 대비 항균시험 시행 후 생육저지환(clear zone)이 22 mm로 20 mm를 초과한 0.63 mg/mL을 적정 농도로 설정하였다(Table III). Paper disc agar diffusion method를 통한 C. difficile 대비 항균시험 결과, 감국, 건강, 결명자, 광곽향, 금은화, 대복피, 대황, 맥문동, 목단피, 백선피, 복분자, 산사, 산수유, 세신, 소엽, 여정실, 연교, 오매, 오수유, 우슬, 정공등, 지실, 통초, 현삼, 황련 등 25종의 약물이 + (8~12 mm) 이상의 생육저지환을 형성하여 C. difficile 대비 항균 효과가 있는 것으로 확인되었다(Table IV, Fig. 1).

Table Ⅱ. List of Herbal Extracts for Antimicrobial Test.

Pharmaceutical name Extract Pharmaceutical name Extract
Puerariae Radix 95.0% EtOH Bupleuri Radix 95.0% EtOH
Chrysanthemi Flos 95.0% EtOH Bupleuri Radix DW
Angelicae koreanae Radix 95.0% EtOH Ligustri Fructus 95.0% EtOH
Zingiberis Rhizoma 95.0% EtOH Ligustri Fructus DW
Zingiberis Rhizoma DW Forsythiae Fructus 95.0% EtOH
Cassiae Semen 95.0% EtOH Forsythiae Fructus DW
Cinnamomi Cortex 95.0% EtOH Nelumbinis Semen 95.0% EtOH
Sophorae Radix 95.0% EtOH Mume Fructus 95.0% EtOH
Pogostemonis Herba 95.0% EtOH Evodiae Fructus 95.0% EtOH
Lycii Fructus 95.0% EtOH Euodiae Fructus DW
Lonicerae Flos 95.0% EtOH Achuranthis Radix 95.0% EtOH
Aloe 95.0% EtOH Polygalae Radix 95.0% EtOH
Angelicae Sinensis Radix 95.0% EtOH Polygalae Radix DW
Arecae Pericarpium 95.0% EtOH Myristicae Semen DW
Arecae Pericarpium DW Coicis Semen 95.0% EtOH
Rhei Rhizoma 95.0% EtOH Coicis Semen DW
Rhei Rhizoma DW Ginseng Radix 95.0% EtOH
Illicii Veri Fructus DW Santalini Lignum Rubrum DW
Eucomiae Cortex 95.0% EtOH Perillae Herba DW
Liriopis Tuber 95.0% EtOH Erycibae Caulis 95.0% EtOH
Liriopis Tuber DW Erycibae Caulis DW
Chaenomelis Fructus 95.0% EtOH Caryophylli Flos DW
PaeoniaSuffruticosa 95.0% EtOH Aurantii Fructus DW
PaeoniaSuffruticosa DW Ponciri Fructus 95.0% EtOH
Saussureae Radix 95.0% EtOH Ponciri Fructus DW
Saussureae Radix DW Gentianae Macrophyllae Radix 95.0% EtOH
Myrrha 95.0% EtOH Gentianae Macrophyllae Radix DW
Pinelliae Tuber 95.0% EtOH Aurantii Nobilis Pericarpium 95.0% EtOH
Ledebouriellae Radix 95.0% EtOH Plantaginis Semen DW
Ledebouriellae Radix DW Xanthii Fructus DW
Pulsatillae Radix 95.0% EtOH Meliae Fructus DW
Dictamni Radicis Cortex 95.0% EtOH Gastrodiae Rhizoma 95.0% EtOH
Dictamni Radicis Cortex DW Gentianae Scabrae Radix 95.0% EtOH
Paeoniae Radix alba 95.0% EtOH Gentianae Scabrae Radix DW
Paeoniae Radix alba DW Alismatis Rhizoma DW
Atractylodis Rhizoma alba 95.0% EtOH Smilacis Rhizoma 95.0% EtOH
Atractylodis Rhizoma alba DW Machili Thunbergi Cortex DW
Dolichoris Semen 95.0% EtOH Tetrapanacis Medulla 95.0% EtOH
Dolichoris Semen DW Tetrapanacis Medulla DW
Cynanchi Wilfordii Radix 95.0% EtOH Fritillariae Bulbus DW
Cynanchi Wilfordii Radix DW Taraxaci Herba 95.0% EtOH
Hoelen 95.0% EtOH Kalopanacis Cortex 95.0% EtOH
Hoelen DW Cyperi Rhizoma 95.0% EtOH
Rubi Fructus 95.0% EtOH Cyperi Rhizoma DW
Rubi Fructus DW Scrophulariae Radix 95.0% EtOH
Amomi Semen 95.0% EtOH Scrophulariae Radix DW
Amomi Semen DW Nepetae Spica 95.0% EtOH
Crataegi Fructus 95.0% EtOH Nepetae Spica DW
Crataegi Fructus DW Scutellariae Radix 95.0% EtOH
Corni Fructus 95.0% EtOH Scutellariae Radix DW
Dioscoreae Rhizoma DW Coptidis Rhizoma 95.0% EtOH
Mori Radicis Cortex 95.0% EtOH Coptidis Rhizoma DW
Acori Graminei Rhizoma 95.0% EtOH Phellodendri Cortex 95.0% EtOH
Asiasari Radix 95.0% EtOH Phellodendri Cortex DW
Perillae Folium 95.0% EtOH Polygonati Rhizoma DW

DW: distilled water, 95.0% EtOH: 95% concentration ethylalcohol..


Table Ⅲ. Antimicrobial Effect of Vancomycin on Clostridium difficile.

Vancomycin concentration (mg/mL) Size of
clear zone
(mm)
Clostridium difficile (KCTC 5009)
2.5 25 ++++
1.25 23 ++++
0.63 22 ++++
0.32 20 +++
0.16 18.5 +++
0.08 1.5 ++
0.04 1.2 +

+: 8~12 mm, ++: 12~16 mm, +++: 16~20 mm, ++++: larger than 20 mm..


Table Ⅳ. Antimicrobial Effect of Herbal Extracts.

Pharmaceutical name Clostridium Difficile (KCTC5009) Bacteroides fragilis (KCTC3688) Bifidobacterium bifidum Lactobacillus plantarum
Chrysanthemi Flos + + - -
Zingiberis Rhizoma + + - -
Cassiae Semen + - - -
Pogostemonis Herba + ++ - -
Lonicerae Flos + ++ - -
Arecae Pericarpium ++ +++ - -
Rhei Rhizoma + ++ - -
Rhei Rhizoma + - - -
Liriopis Tuber + - - -
PaeoniaSuffruticosa + - + -
PaeoniaSuffruticosa + - - -
Dictamni Radicis Cortex ++ - - -
Rubi Fructus + ++ - -
Crataegi Fructus +++ ++++ - -
Corni Fructus +++ ++++ - -
Asiasari Radix + ++++ + -
Perillae Folium + +++ + -
Ligustri Fructus ++ ++ - -
Forsythiae Fructus ++ +++ - -
Mume Fructus +++ - ++ -
Evodiae Fructus + ++ - -
Achuranthis Radix + ++ - -
Erycibae Caulis + + - -
Ponciri Fructus ++ +++ - -
Tetrapanacis Medulla ++++ - +++ +++
Tetrapanacis Medulla +++ - +++ +++
Scrophulariae Radix + + - -
Coptidis Rhizoma +++ ++ +++ -
Coptidis Rhizoma + ++ +++ -
Vancomycin (0.65 mg/mL) ++++ + +++ -

+: 8~12 mm, ++: 12~16 mm, +++: 16~20 mm, ++++: larger than 20 mm..


Fig. 1. Paper disc agar method to identify antimicrobial effect on Clostridium difficile. V 2.5: vancomycin 2.5 mg/mL, V 1.25: vancomycin 1.25 mg/mL, V 0.63: vancomycin 0.63 mg/mL, V 0.32: vancomycin 0.32 mg/mL, V 0.16: vancomycin 0.16 mg/mL, 30% DMSO: 30% concentration dimethyl sulfoxide, 1, 2, 3: candidate herbal medicine number 1, 2, 3.

2. 상재균 및 유익균 대비 항균 효과

생육저지환이 + (8~12 mm) 이상으로 C. difficile 대비 항균 효과가 확인된 25종의 약물을 대상으로 하여 상재균인 Bacteroides fragilis 및 유익균인 B. bifidum, L. plantarum 관련 항균시험을 시행하였다. Bacteroides fragilis에 항균력을 보인 약물로 감국, 건강, 광곽향, 금은화 등 19종이 확인되었으며, B. bifidum에 항균력을 보인 약물로는 목단피, 세신, 소엽, 오매 등 6종이 확인되었고, L. plantarum에 항균력을 보인 약물은 통초 1종으로 확인되었다.

추출법에 따라 항균력에 있어 차이를 보이는 약물이 확인되었다. 대황, 목단피, 통초, 황련은 95% 에탄올 추출과 증류수 추출 두가지 방법으로 얻어졌는데 대황의 경우 C. difficile 관련 항균 효과가 생육저지환 + (8~12 mm)로 동일하였으나, Bacteroides fragilis 관련 항균 효과가 증류수 추출물에서는 확인되지 않은 반면 95% 에탄올 추출물에서는 생육저지환이 ++ (12~16 mm)로 확인되었다. 목단피의 경우에도 95% 에탄올 추출물과 증류수 추출물에서 C. difficile 관련 항균 효과가 생육저지환 + (8~12 mm)로 동일하였으나 B. bifidum과 관련하여 증류수 추출물에서는 항균 효과가 확인되지 않은 반면 95% 에탄올 추출물에서는 + (8~12 mm)로 확인되었다. 통초 및 황련의 경우 상재균 Bacteroides fragilis 및 유익균 B. bifidum, L. plantarum 대비 항균 효과가 95% 에탄올 추출물 및 증류수 추출물에서 동일하였으나, C. difficile 대비 항균 효과가 95% 에탄올 추출물이 증류수 추출물에 비해 더 높은 것으로 확인되었다(Table IV, Fig. 2).

Fig. 2. Paper disc agar method to identify antimicrobial effect on commensal and beneficial bacteria. (A) Paper disc agar method applied to Bifidobacterium bifidum, (B) Paper disc agar method applied to Bacteroides fragilis, (C) Paper disc agar method applied to Lactobacillus plantarum. 30% DMSO: 30% concentration dimethyl sulfoxide, V 0.63: vancomycin 0.63 mg/mL, 1, 2, 3: candidate herbal medicine number 1, 2, 3.

3. 최종후보 선정 및 MIC 확인

C. difficile 관련 항균력이 생육저지환 +++ (16~20 mm) 이상으로 확인된 산사, 산수유, 오매, 통초, 황련이 후보 물질로 선정되었다. 통초의 경우 유익균인 B. bifidumL. plantarum 대비 생육저지환 +++ (16~20 mm)로 항균력이 확인되어 후보에서 제외하였다(Table IV).

산사, 산수유, 오매, 황련을 30% 에탄올 추출하여 동일한 시험을 반복한 결과, 산사, 산수유, 오매는 C. difficile 대비 생육저지환 +++ (16~20 mm) 이상의 우수한 항균력을 보인 반면, 황련은 생육저지환 ++ (12~16 mm)으로 비교적 약한 항균력을 보였으며, 유익균인 B. bifidum 대비 생육저지환 ++ (12~16 mm)의 항균력을 가지는 것으로 확인되어 최종 후보에서 제외하였다(Table V, Fig. 3).

Table Ⅴ. Antimicrobial Effect of 30% Ethanol Herbal Extracts.

Pharmaceutical name Extract Clostridium Difficile (KCTC5009) Bacteroides fragilis (KCTC3688) Bifidobacterium bifidum Lactobacillus plantarum
Crataegi Fructus 30% EtOH +++ +++ - -
Corni Fructus 30% EtOH ++++ +++ - -
Mume Fructus 30% EtOH ++++ ++++ - -
Coptidis Rhizoma 30% EtOH ++ ++ ++ -
Vancomycin (2.5 mg/mL) ++++ +++ ++++ -
Vancomycin (1.25 mg/mL) ++++ +++ ++++ -
Vancomycin (0.63 mg/mL) ++++ ++ +++ -

+: 8~12 mm, ++: 12~16 mm, +++: 16~20 mm, ++++: larger than 20 mm, 30% EtOH: 30% concentration ethylalcohol..


Fig. 3. Antimicrobial effect of 30% ethanol herbal extracts. (A) Paper disc agar method applied to Clostridium difficile, (B) Paper disc agar method applied to Bifidobacterium bifidum, (C) Paper disc agar method applied to Bacteroides fragilis, (D) Paper disc agar method applied to Lactobacillus plantarum. V 2.5: vancomycin 2.5 mg/mL, V 1.25: vancomycin 1.25 mg/mL, V 0.63: vancomycin 0.63 mg/mL, 30% DMSO: 30% concentration dimethyl sulfoxide, CR: Coptidis Rhizoma, MF: Mume Fructus, CF1: Crataegi Fructus, CF2: Corni Fructus.

최종 후보로 산사, 산수유, 오매를 선정하여 MIC test를 시행하였다. 시험 결과, 각각의 MIC는 산사는 10 mg/mL, 산수유는 20 mg/mL, 오매는 5 mg/mL로 확인되었다(Table VI).

Table Ⅵ. MIC of 30% Ethanol Herbal Extract in Clostridium difficile.

Herbal extract Growth of various concentration (mg/mL)

20 10 5 2.5 1.25 0.63 0.63 0.31 0.15 0.08 0.04 0 MIC
Crataegi fructus - + + + + + + + + + + 10
Corni fructus - + + + + + + + + + + + 20
Mume fructus - - - + + + + + + + + + 5

MIC: minimal inhibitory concentration, -: no growth, +: growth..


고찰»»»

C. difficile은 1978년에 위막성 대장염 환자에서 발견되었다고 보고된 균주이다23). 주로 산소농도가 낮은 하부위장관에서 증식하여 독소들을 분비하는데 이들 중 toxin A는 장상피세포의 tight junction을 느슨하게 만들어 toxin A보다 약 1,000배 가량 독성이 높은 toxin B가 장상피세포 내로 침입하도록 돕고 조직을 손상시키는 염증반응을 일으킨다1,24). 재활치료를 위해 입원하는 뇌손상 및 척수손상 환자를 대상으로 입원 시 직장도말 검사를 실시한 결과 약 16%가 C. difficile 양성으로 확인될 만큼 CDI는 흔하며 입원 환자 간 C. difficile 발생률은 전반적으로 증가하는 추세이다7,25). 따라서 한방재활의학과의 주요 환자군 중 재활을 위해 병원에 비교적 장기 재원하는 환자들의 경우 C. difficile의 감염 및 치료에 보다 각별한 주의가 필요하다.

CDI 치료에 항생제가 적극적으로 이용됨에 따라 내성을 가진 균주가 출현하게 되었다. 1978년부터 1983년까지의 clindamycin, 1983년부터 2003년까지 cephalosporin계와 fluoroquinolone계 항생제의 사용이 내성 균주의 출현과 연관되어 있다고 여겨지고 있으며, 2003년부터 2006년 사이에 변종 C. difficile 균주 BI/NAP1/027가 출현하면서 발생빈도 및 위험성, 재발률 등이 증가하며 치료가 어려워진 실정이다2). Metronidazole과 vancomycin이 1970년대부터 CDI 치료에 주축이 되어 사용되고 있으나 여전히 재발의 위험이 존재한다. 이와 관련하여 2011년에 혐기성 그람양성 박테리아에 대항하는 fidaxomicin이 미국 식품의약국(Food and Drug Administration)의 승인을 받아 사용되기 시작하였다. 치료율은 90%로 vancomycin과 유사하였으며 재발률이 15%로 vancomycin이 25%인 것과 비교하여 비교적 낮았으나, 앞서 언급한 BI/NAP1/027 균주에게서는 재발률이 38%로 확인되었으며, 비용이 vancomycin보다 비싸다는 단점이 존재하여 여전히 사용이 제한되고 있다7).

한편 장내 미생물의 불균형으로 인하여 CDI가 발생하는 것과 관련하여 probiotics는 아직 논쟁의 여지가 있으나 광범위하게 사용되고 있다2). Probiotics는 장내 미생물 불균형을 회복시키는 것으로 잘 알려져 있으며, Ruminococcus gnavus과 같은 장 내에 상재하는 특정 미생물은 인체에 해로울 수 있다고 알려진 이차담즙산을 해독하여 C. difficile의 성장을 억제하는 것으로 알려져 있다1). 본 연구에서는 C. difficile을 억제하는 한편, probiotics인 B. bifidumL. plantarum을 억제하지 않은 약물을 찾는 것을 목표로 하였으며 더불어 상재균 중 하나인 Bacteroides fragilis에 미치는 영향을 알아보고자 하였다26,27).

이번 연구에서 77종의 후보 약물 중 25종이 C. difficile 대비 생육저지환 + (8~12 mm) 이상의 항균 효과를 보이는 것으로 확인되었다. 이들 중 산사, 산수유, 오매, 통초, 황련이 C. difficile 대비 생육저지환 +++ (16~20 mm) 이상으로 타 약물 대비 강력한 억제 효과를 보여 후보로 선정되었다. 통초의 경우 95% 에탄올 추출물과 증류수 추출물 모두에서 probiotics인 B. bifidum, L. plantarum에 대하여 생육저지환 +++ (16~20 mm)의 억제 효과가 확인되어 최종 후보에서 제외하였다. 황련은 95% 에탄올 추출물과 증류수 추출물 모두에서 유익균 중 B. bifidum에 대하여 생육저지환 +++ (16~20 mm)의 억제 효과가 확인되었으나, 각각의 균주에 대한 억제효과가 vancomycin과 유사한 형태를 보였으며, 95% 에탄올 추출물과 증류수 추출물에 따른 C. difficile 억제 효과에 차이가 보여 산사, 산수유, 오매와 더불어 30% 에탄올 추출물을 제조하여 항균시험을 시행하였다. 30% 에탄올 추출물로 시험을 진행한 결과 산사, 산수유, 오매가 C. difficileBacteroides fragilis에 대하여 생육저지환 +++ (16~20 mm) 이상의 억제 효과를 보이는 것으로 확인되었다. 황련은 C. difficileBacteroides fragilis에 대하여 생육저지환 ++ (12~16 mm)로 상대적으로 낮은 억제 효과를 보였으며, 유익균인 B. bifidum에 대하여 생육저지환 ++ (12~16 mm)의 억제 효과가 확인되었다. 따라서 최종 후보 약물로 산사, 산수유, 오매를 선정하여 MIC 측정을 시행하였으며, 각각의 MIC는 10 mg/mL, 20 mg/mL, 5 mg/mL로 확인되었다.

‘항생제’는 숙주에게 위해를 최소화하면서 세균의 성장을 억제하거나 죽이는 화합물을 의미한다. 대부분의 항균제가 세균이나 진균 자원에 의존하고 있으나, 이 외에도 식물에서 기원한 phenolics, terpenoids, alkaloids, lectins, polyacetylenes 등의 화합물이 항균 효과를 보인다고 알려져 있다28,29). 황련은 중국에서 식물성 항균물질로 각광받고 있는 대표적인 淸熱약물로써30), berberine, jatrorrhizine, palmatine, coptisine 등 항균 효과를 가진 alkaloids를 포함하고 있으며 Streptococcus agalactiae, Staphylococcus aureus, Enterococcus faecium 등의 균주를 억제하는 것으로 알려져 있다31,32). 하지만 본 연구에서는 C. difficile 억제 효과가 산사, 산수유, 오매와 비교하여 상대적으로 낮았으며, 양성대조군인 vancomyicn과 동일한 패턴으로 유익균인 B. bifidum에 대해서 억제 효과가 확인되어 C. difficile 항균 약물로써 우위를 점하기는 어려운 것으로 판단되었다.

산사는 한의학의 대표적인 消食藥으로 食積停滯에 다용되며, 驅蟲止痢 작용이 있어 腹痛泄瀉을 치료하는데 사용되기도 한다33). 산사의 주요 성분으로는 crataegolic acid, malic acid, citric acid, vitamin C, tannin, saponin이 있으며, 이 중 tannin과 saponin이 항균 작용을 하는 것으로 알려져 있다29). 산사가 C. difficile에 대한 항균활성을 보이지 않았다는 이전 연구도 존재하나34), 본 연구에서는 준수한 효과를 보이는 것으로 확인되었다. 산수유는 澁精藥으로 약리 효능으로 抗菌作用을 보이는데 그 주요 성분으로 morroniside, loganin, cornin, gallic acid, tartaric acid, malic acid가 있다35). 이들 중 gallic acid는 Staphylococcus aureus에 항균 효과를 보이는 것으로 알려졌으며29), 산수유 추출물이 Escherichia coli, Pseudomonas aeruginosa 등의 유해 균주에 항균 효과를 보였다는 연구가 존재한다36). 오매는 止瀉藥로 분류되며 澁腸止瀉이 있어 久瀉久痢를 치료하는 약재로 citric acid, sitosterol, oleanolic acid, kaemf.-7-glucoside 등을 주요 성분으로 하며37), Enterobacteria, E. coli, Klebsiella pneumoniae 등의 균주와 관련하여 그 효과가 보고된 바 있다38-40). 위와 같이 C. difficile에 효과를 보였던 약물인 산사, 산수유, 오매는 한의학적으로 止瀉 혹은 抗菌 작용을 가지는 약물들로 확인되었다.

한의학적 약물치료로 한약은 단미로써 사용되기도 하지만 일반적으로 두가지 이상의 약재를 조합하여 복방으로 사용하는 경우가 많으며 항균 작용과 관련하여 단미약재보다 약물을 조합하여 사용하였을 때 그 효과가 증강될 수 있다41,42). 본 연구결과 C. difficile 관련하여 항균 효과가 있다고 밝혀진 산사, 산수유, 오매를 포함한 소화기계 관련 처방으로 胃腸諸疾을 主治하는 桂薑養胃湯이 확인되었으며43) 추후 CDI 관련 추가적인 연구가 필요할 것으로 생각된다.

본 연구에서 산사, 산수유, 오매는 CDI 표준 치료 항생제인 vancomycin이 유익균 B. bifidum에 항균작용을 가지는 것과 비교하여 유익균 B. bifidumL. plantarum에 대한 억제 없이 C. difficile 대비 억제효과를 가지는 것으로 확인되었다. 하지만 vancomycin과 동일하게 상재균인 Bacteroides fragilis 관련 억제 효과를 가지는 것이 관찰되었다. 장내 미생물이 어떠한 기전으로 C. difficile에 억제 효과를 미치는지 아직 완벽하게 규명되지 않아 후보 약재들이 상재균에 영향을 미치는 것이 확인된 이상 임상에서의 효과를 단정할 수 없다. 또한 장내 미생물 이외에도 포자형성 환경, 숙주의 면역 환경 등이 CDI에 복합적으로 작용하기 때문에 C. difficile에 직접 억제 효과를 보이는 것만으로 CDI에 효과가 있다고 확신하기는 어렵다. 따라서 추후 연구는 생체 투여 시에 나타나는 효과에 대한 연구가 추가되어야 할 것이다. 마지막으로 본 연구에서 증류수, 에탄올 등 추출 용매의 종류 및 용매 농도에 따른 항균 효과의 차이가 관찰되었기 때문에 경제성 평가를 동반한 최적의 추출방식을 찾는 연구가 시행되어야 할 것이다.

결론»»»

Paper disc agar diffusion method를 통해 한약재의 C. difficile 관련 항균 효과를 알아보기 위한 연구 결과는 다음과 같다.

  • 77종 한약재의 C. difficile 대비 효과를 탐색한 결과 감국, 건강, 결명자, 광곽향, 금은화, 대복피, 대황, 맥문동, 목단피, 백선피, 복분자, 산사, 산수유, 세신, 소엽, 여정실, 연교, 오매, 오수유, 우슬, 정공등, 지실, 통초, 현삼, 황련 등 25종의 약물이 생육저지환을 형성하여 C. difficile 대비 항균 효과를 보였다.

  • C. difficile 대비 항균력은 전반적으로 증류수 추출물보다 에탄올 추출물에서 증식억제 효과가 높았다.

  • 산사, 산수유, 오매, 통초, 황련이 C. difficile 대비 생육저지환 +++ (16~20 mm) 이상으로 vancomycin (0.63 mg/mL)의 ++++ (larger than 20 mm)과 비교하여 준수한 억제 효과를 보였다.

  • 통초의 경우 유익균인 B. bifidumL. plantarum 대비 생육저지환 +++ (16~20 mm)으로 억제 효과가 확인되어 후보에서 제외하였다.

  • 황련의 경우 유익균인 B. bifidum에 대하여 생육저지환 ++ (12~16 mm)의 억제 효과가 확인되어 후보에서 제외하였다.

  • 30% 에탄올 추출 산사, 산수유, 오매는 유익균 B. bifidum, L. plantarum에 대한 억제 없이 C. difficile 대비 항균 효과를 보였다.

  • 30% 에탄올 추출 산사, 산수유, 오매의 C. difficile 대비 MIC는 각각 10 mg/mL, 20 mg/mL, 5 mg/mL인 것으로 확인하였다.

  • 본 연구 결과 C. difficile 대비 항균 효과를 가진 산사, 산수유, 오매를 포함한 소화기계 관련 처방으로 桂薑養胃湯이 확인되었다.

이상의 결과로 보아 산사, 산수유, 오매가 유익균 B. bifidum, L. plantarum에 대한 억제 없이 C. difficile에 항균 효과를 보인다는 것을 확인하였으며 추가적 연구를 통해 C. difficile 치료 후보 물질로써 활용될 수 있을 것으로 사료된다.

References
  1. Abt MC, McKenney PT, Pamer EG. Clostridium difficile colitis: pathogenesis and host defence. Nat Rev Microbiol. 2016;14(10):609-20.
    Pubmed KoreaMed CrossRef
  2. Hookman P, Barkin JS. Clostridium difficile associated infection, diarrhea and colitis. World J Gastroenterol. 2009;15(13):1554.
    Pubmed KoreaMed CrossRef
  3. Khanna S, Pardi DS. The growing incidence and severity of Clostridium difficile infection in inpatient and outpatient settings. Expert Rev Gastroenterol Hepatol. 2010;4(4):409-16.
    Pubmed CrossRef
  4. Weppner J, Gabet J, Linsenmeyer M, Yassin M, Galang G. Clostridium difficile infection reservoirs within an acute rehabilitation environment. Am J Phys Med Rehab. 2020;100(1):44-7.
    Pubmed CrossRef
  5. Choi HY, Park SY, Kim YA, Yoon TY, Choi JM, Choe BK, Ahn SH, Yoon SJ, Lee YR, Oh IH. The epidemiology and economic burden of Clostridium difficile infection in Korea. Biomed Res Int. 2015;2015:510386.
    Pubmed KoreaMed CrossRef
  6. Tanovic E, Tanovic H, Kadic A, Vrabac D, Selimović S, Kostić D. The effect of the infection Clostridium difficile on the rehabilitation. J Health Sci. 2014;4(1):55-8.
    CrossRef
  7. Leffler DA, Lamont JT. Clostridium difficile infection. N Engl J Med. 2015;372(16):1539-48.
    Pubmed CrossRef
  8. Spigaglia P, Mastrantonio P, Barbanti F. Antibiotic resistances of Clostridium difficile. Adv Exp Med Biol. 2018;1050:137-59.
    Pubmed CrossRef
  9. Shin YJ, Lee BJ. Fecal microbiota transplantation as a treatment of recurrent Clostridium difficile infection: where are we now and where are we heading? Korean J Gastroenterol. 2017;69(4):203-5.
    CrossRef
  10. Gao Y, Li H, Yang H, Su J, Huang L. The current novel therapeutic regimens for Clostridium difficile infection (CDI) and the potentials of traditional Chinese medicine in treatment of CDI. Crit Rev Microbiol. 2019;45(5-6):729-42.
    Pubmed CrossRef
  11. Ya-Nan G, Jun W, Hao-Jun Z, Hong-Bing J, Ping L, Xin-Zhu L. Traditional Chinese medicine QPYF as preventive treatment for Clostridium difficile associated diarrhea in a mouse model. Evid Based Complement Alternat Med. 2016;2016:3759819.
    Pubmed KoreaMed CrossRef
  12. Aljarallah KM. Inhibition of Clostridium difficile by natural herbal extracts. J Taibah Univ Med Sci. 2016;11(5):427-31.
    CrossRef
  13. Hammond EN, Donkor ES. Antibacterial effect of Manuka honey on Clostridium difficile. BMC Res Notes. 2013;6(1):188.
    Pubmed KoreaMed CrossRef
  14. Shilling M, Matt L, Rubin E, Visitacion MP, Haller NA, Grey SF, Woolverton CJ. Antimicrobial effects of virgin coconut oil and its medium-chain fatty acids on Clostridium difficile. J Med Food. 2013;16(12):1079-85.
    Pubmed CrossRef
  15. Finegold SM, Summanen PH, Corbett K, Downes J, Henning SM, Li Z. Pomegranate extract exhibits in vitro activity against Clostridium difficile. Nutrition. 2014;30(10):1210-2.
    Pubmed CrossRef
  16. Georgescu M, Ginghina O, Raita S, Tapaloaga D, Ilie L, Negrei C, Popa DE, Varlas V, Multescu R, Rosca AC, Mirica R, Georgescu D. Natural alternative remedies in the background of updated recommendations for the prophylactic and therapeutic approach of clostridium difficile infections. Farmacia. 2018;66:563-72.
    CrossRef
  17. Lee IC, Kim MK. Antioxidant, antimicrobial and anti-inflammatory of mixed medicinal herb extract. Kor J Herbol. 2015;30(5):51-8.
    CrossRef
  18. Lee B-W, Shin D-H. Screening of natural antimicrobial plant extract on food spoilage microorganisms. Korean J Food Sci Technol. 1991;23(2):200-4.
  19. Park UY, Chang DS, Cho HR. Screening of antimicrobial activity for medicinal herb extracts. J Korean Soc Food Sci Nutr. 1992;21(1):91-6.
  20. Surawicz CM, Brandt LJ, Binion DG, Ananthakrishnan AN, Curry SR, Gilligan PH, McFarland LV, Mellow M, Zuckerbraun BS. Guidelines for diagnosis, treatment, and prevention of Clostridium difficile infections. Am J Gastroenterol. 2013;108(4):478-98.
    Pubmed CrossRef
  21. Kato N, Ou C-Y, Kato H, Bartley SL, Brown VK, Dowell VR, Ueno K. Identification of toxigenic Clostridium difficile by the polymerase chain reaction. J Clin Microbiol. 1991;29(1):33-7.
    Pubmed KoreaMed CrossRef
  22. Wiegand I, Hilpert K, Hancock RE. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 2008;3(2):163.
    Pubmed CrossRef
  23. Bartlett JG, Chang TW, Gurwith M, Gorbach SL, Onderdonk AB. Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia. N Engl J Med. 1978;298(10):531-4.
    Pubmed CrossRef
  24. Starr J. Clostridium difficile associated diarrhoea: diagnosis and treatment. Bmj. 2005;331(7515):498-501.
    Pubmed KoreaMed CrossRef
  25. Marciniak C, Chen D, Stein AC, Semik PE. Prevalence of Clostridium difficile colonization at admission to rehabilitation. Arch Phys Med Rehabil. 2006;87(8):1086-90.
    Pubmed CrossRef
  26. Huang JY, Lee SM, Mazmanian SK. The human commensal Bacteroides fragilis binds intestinal mucin. Anaerobe. 2011;17(4):137-41.
    Pubmed KoreaMed CrossRef
  27. Wang Y, Guo Y, Chen H, Wei H, Wan C. Potential of Lactobacillus plantarum ZDY2013 and Bifidobacterium bifidum WBIN03 in relieving colitis by gut microbiota, immune, and anti-oxidative stress. Can J Microbiol. 2018;64(5):327-37.
    Pubmed CrossRef
  28. Rahman M, Sarker S. Antimicrobial natural products. Cambridge, MA:Academic Press. 2020.
    Pubmed KoreaMed CrossRef
  29. Cowan MM. Plant products as antimicrobial agents. Clin Microbiol Rev. 1999;12(4):564-82.
    Pubmed KoreaMed CrossRef
  30. Korea Pharmaceutical Information Center. Information of herbal medicines [Internet] [cited 2020 Oct 27].
    Available from: https://www.health.kr/researchInfo/herbalMedicine1_detail.asp?idx=346.
  31. Yang Y, Ye X, Li X. Antimicrobial effect of four alkaloids from Coptidis Rhizome. Lishizhen Med Mater Med Res. 2007;18(12):3013-4.
  32. Wang J, Wang L, Lou G-H, Zeng H-R, Hu J, Huang Q-W, Peng W, Yang X-B. Coptidis Rhizoma: a comprehensive review of its traditional uses, botany, phytochemistry, pharmacology and toxicology. Pharm Biol. 2019;57(1):193-225.
    Pubmed KoreaMed CrossRef
  33. Korea Pharmaceutical Information Center. Information of herbal medicines [Internet] [cited 2020 Oct 27].
    Available from: https://www.health.kr/researchInfo/herbalMedicine1_detail.asp?idx=537.
  34. Jung SM, Choi SI, Park SM, Heo TR. Antimicrobial effect of Achyranthes japonica Nakai extracts against Clostridium difficile. Korean J Food Sci Technol. 2007;39(5):564-8.
  35. Korea Pharmaceutical Information Center. Information of herbal medicines [Internet] [cited 2020 Oct 27].
    Available from: https://www.health.kr/researchInfo/herbalMedicine1_detail.asp?idx=473.
  36. Mau J-L, Chen C-P, Hsieh P-C. Antimicrobial effect of extracts from Chinese chive, cinnamon, and corni fructus. J Agric Food Chem. 2001;49(1):183-8.
    Pubmed CrossRef
  37. Korea Pharmaceutical Information Center. Information of herbal medicines [Internet] [cited 2020 Oct 27].
    Available from: https://www.health.kr/researchInfo/herbalMedicine1_detail.asp?idx=466.
  38. Mitani T, Ota K, Inaba N, Kishida K, Koyama HA. Antimicrobial activity of the phenolic compounds of Prunus mume against Enterobacteria. Biol Pharm Bull. 2018;41(2):208-12.
    Pubmed CrossRef
  39. Lee JH, Stein BD. Antimicrobial activity of a combination of Mume fructus, Schizandrae fructus, and Coptidis rhizoma on enterohemorrhagic Escherichia coli O26, O111, and O157 and its effect on Shiga toxin releases. Foodborne Pathog Dis. 2011;8(5):643-6.
    Pubmed CrossRef
  40. Lin T-H, Huang S-H, Wu C-C, Liu H-H, Jinn T-R, Chen Y, Lin CT. Inhibition of Klebsiella pneumoniae growth and capsular polysaccharide biosynthesis by Fructus mume. Evid Based Complement Alternat Med. 2013;2013; doi:10.1155/2013/621701.
    Pubmed KoreaMed CrossRef
  41. Kim SY, Kim JH, Yu KY, Lee HS, Jeon IH, Kang HJ, Lee JN, Choi BM Jang SI. Synergic antimicrobial activity of Scutellariae Radix, Coptidis Rhizoma and Salicylic Acid combination against Escherichia coli and Pseudomonas aeruginosa. J Physiol & Pathol Korean Med. 2014;28(4):390-5.
    Pubmed KoreaMed CrossRef
  42. Kwon HA, Kwon Y-J, Kwon D-Y, Lee JH. Evaluation of antibacterial effects of a combination of Coptidis Rhizoma, Mume Fructus, and Schizandrae Fructus against Salmonella. International Journal of Food Microbiology. 2008;127(1-2):180-3.
    Pubmed CrossRef
  43. Korean Traditional Knowledge Portal [Internet] [cited 2020 Oct 27].
    Available from: https://www.koreantk.com/ktkp2014/prescription/prescription-view.view?preCd=P0019860.


January 2021, 31 (1)

Cited By Articles
  • CrossRef (0)

  • Crossref TDM
  • CrossMark
  • orcid