search for




 

J Korean Med Rehabi 2022 Oct; 32(4): 1-8  https://doi.org/10.18325/jkmr.2022.32.4.1
Anti-Obesity Effects of Gastrodia elata Extracts on High Fat Diet-Induced Obese Mice
Published online October 31, 2022
Copyright © 2022 The Society of Korean Medicine Rehabilitation.

Ye-Seul Kim, Ph.D.*, Ha-Rim Kim, Ph.D.*, Eun-Hee Park, Ph.D.*, Young-Eun Song, Ph.D., Chang-Su Kim, Ph.D., Won-Bae Ha, K.M.D., Hyeon-Jun Woo, K.M.D., Yun-Hee Han, K.M.D., Jung-Han Lee, K.M.D.

Department of Physiology, School of Korean Medicine, Wonkwang University*, Jeollabuk-Do Agricultural Research & Extension Services, Department of Korean Medicine Rehabilitation, College of Korean Medicine, Wonkwang University
Correspondence to: Jung-Han Lee, Department of Korean Medicine Rehabilitation, College of Korean Medicine, Wonkwang University, 895 Muwang-ro, Iksan 54538, Korea
TEL (063) 859-2807
FAX (063) 841-0033
E-mail milpaso@wku.ac.kr

본 연구는 2021년도 지역특화기술개발연구사업 지원에 의한 연구임(Project No. PJ016156).
Received: October 6, 2022; Accepted: October 7, 2022
Abstract
Objectives This study is to investigate the effects and mechanisms of Gastrodia elata extract (GEE) on the high-fat diet-induced obesity model.
Methods C57BL/6 mice were randomly assigned into 5 groups (n=10). Control group was fed normal diet (ND). Obesity group was fed 60% high fat diet (HFD). The other three groups were fed HFD with 100, 200, 500 mg/kg GEE. After five weeks, body weight, liver and epididymal fat weight, triglyceride concentration in liver and serum, sterol regulatory element-binding protein-1 (SREBP-1), acetyl-CoA carboxylase (ACC), fatty acid synthase, peroxisome proliferator-activated receptor γ (PPAR-γ), CCAAT/enhancer binding protein α (C/EBP-α) expression level, insulin concentration in serum were measured.
Results The GEE (100, 200, and 500 mg/kg)-treated animals exhibited substantial decreases in body mass, liver weight and epididymal white adipose tissue collate to the HFD-fed group. GEE treatment also reduced hepatic and serum triglyceride level. Furthermore, GEE treatment significantly inhibited adipogenesis in the GEE group by reducing the protein expression of SREBP-1, ACC and the messenger RNA expression of PPARγ, C/EBP-α, which are adipocyte differentiation-related genes.
Conclusions These research outcomes recommend that GEE is possibly valuable for the prevention of HFD-induced obesity via modification of various pathways related with adipogenesis and adipocyte differentiation.
Keywords : Gastrodia elata extract, Obesity, High-fat diet, Adipogenesis
서론»»»

비만은 체내에 지방이 필요 이상으로 과도하게 쌓인 것을 의미하며, 제2형 당뇨병, 고혈압, 이상지질혈증, 지방간 등 다양한 합병증과 관련이 있는 것으로 알려져 있다1). 체질량지수 25 kg/m2 이상을 기준으로 비만 유병률 추이를 조사하였을 때 2020년 비만 유병률이 성인 남녀 모두에서 크게 증가하였으며, 남성의 경우 48%의 유병률이 나타나 비만이 사회적인 문제로 대두되고 있다2).

Spiegelman과 Flier는 에너지 섭취량이 에너지 소비량을 초과하면 대부분의 초과된 에너지는 중성지방 형태로 지방 조직에 저장되며, 지방조직은 지방세포의 크기나 지방세포 수의 증가를 통해 증가한다고 밝혔다3). 또한 비만은 이러한 지방세포의 크기 및 지방세포의 수와 밀접한 관련이 있으며, 이러한 에너지 균형 조절에 지방분화 전기 세포의 성장, 지방세포 분화(adipogenesis), 지방세포에서의 지방합성(lipogenesis)이 중요한 열쇠라고 언급되었다. Moseti 등4)은 peroxisome proliferator- activated receptor γ (PPAR-γ)가 지방세포 분화의 주요 조절인자이자 전사인자로 PPAR-γ 없이는 지방분화 전기세포가 성숙 지방세포로 분화되지 않는다고 보고하였다. 한편 Rosen 등5)은 CCAAT/enhancer binding protein α (C/EBP-α)가 지방세포 분화 단계에서 PPAR-γ의 발현을 유지시키고 지방세포 분화를 조절하는 것 외에 인슐린 민감도에 관여한다고 보고하였다. Rosen과 MacDougald6), Czech 등7)은 sterol regulatory element-binding protein-1 (SREBP-1)가 지방세포 전기 전사인자로써 PPAR-γ의 발현을 유도하고, 지방세포에서 인슐린에 의한 지방 생합성의 유도에 관여한다고 보고하였다. 또한 지방합성 관련 유전자인 fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC)를 조절하는 것으로 알려져 있다.

천마(天麻, Gastrodiae rhizoma)는 난초과(Orchidaveae)에 속한 다년생 기생초본인 천마(Gastrodia elata BL.) 및 동속 근연식물의 근경을 건조한 것이다8,9). 실험적으로 신경보호 효과10), 항치매 효과11), 항당뇨 효과12) 등이 보고되었으나 항비만 효과에 대한 연구는 없었다. 이에 천마 추출물을 고지방 사료로 유도한 마우스 비만 모델에 투여한 후 항비만 효과 및 기전을 조사하여 유의한 결과를 얻었기에 보고하는 바이다.

재료 및 방법»»»

1. 천마 추출물의 제조

본 연구에 사용된 (건)천마(Gastrodia elata)는 무주농협(Muju, Korea)에서 구입하여 다음과 같이 추출하였다. 천마 100 g에 15배수의 물을 투입한 후 90℃에서 6시간 전탕하여 추출물을 얻어 여과하고, 다시 1차 잔여물에 15배수의 물을 넣어 90℃에서 6시간 전탕하여 2차 추출물을 얻어 여과한 후 1, 2차 추출물을 혼합, 농축, 살균, 분무건조를 하여 30.2 g의 추출물을 획득하였다.

2. 실험동물

8주령의 C57BL/6 수컷 마우스(22-24 g)를 오리엔트바이오(Seongnam, Korea)에서 공급받아 실험동물 사육실에서 정상식이 사료로 자유 급식 하에 1주일 동안 적응시킨 후 실험에 사용하였다. 사육 기간 중 온도는 18~ 24℃, 습도 50~60%, 조명시간 08:00~20:00 (1일 12시간)의 환경에서 사육하였으며, 사료와 음수는 자유롭게 섭취하도록 공급하고, 체중은 주 1회 측정하였다. 시작 전 마우스를 각 군별 시작 평균 체중이 유사하도록 실험군을 배정하였다(Table I). 정상식이 대조군(normal diet군, ND군), 고지방식이 대조군(high fat diet군, HFD군), 고지방식이와 저농도, 중농도, 고농도의 천마 추출물을 투여한 실험군으로 배정하여 5주간 경구 투여하였다. 정상식이는 오리엔트바이오의 LabDiet 5L79를 사용하였고, 고지방식이 사료는 총 열량의 60%가 지방으로 구성된 Research Diets, Inc. (New Brunswick, NJ, USA)의 Rodent Diet with 60% kcal% fat (D12492)를 사용하였다. 사용 식이의 열량 기준 조성 표는 Table II에 정리하였다. 실험 종료 전날 밤 절식하고 4시간 동안 식이를 재급여한 후 마우스를 희생시켜 혈액을 채취하고 간, 부고환 지방을 적출하여 조직의 무게를 측정하였다. 혈액은 실온에서 30분간 방치한 후 원심분리기(Hanil Scientific Inc., Gimpo, Korea)를 이용하여 2,500 rpm에서 10분간 혈청을 분리하여 실험에 사용하였다. 본 연구에 사용된 동물 실험에 관련된 모든 실험과정과 절차는 원광대학교 동물실험윤리위원회의 사전심의와 윤리 규정을 준수하여 수행되었다(WKU 21-84).

Table I. Classification of Experimental Groups.

Group Treatment
ND Normal diet + saline
HFD HFD + saline
GEE 100 mg/kg HFD + GEE 100 mg/kg
GEE 200 mg/kg HFD + GEE 200 mg/kg
GEE 500 mg/kg HFD + GEE 500 mg/kg

HFD: high fat diet, GEE: Gastrodia elata extract..



Table Ⅱ. Composition of Mice Diet.

Ingredient (kcal%) Normal diet High fat diet
Protein 21.028 20
Carbohydrate 65.304 20
Fat 13.668 60


3. 혈청 및 간 조직의 중성지방 농도 측정

혈청 중성지방의 함량은 혈청을 사용하여 측정하였고, 간 조직 내 중성지방의 함량은 Cho 등13)의 방법과 Lee 등14)의 방법을 응용하여 다음의 과정에 따라 검체를 만들어 측정하였다. 간 조직을 5%의 Triton-X 100 수용액과 함께 균질화하고 80℃에서 10분간 3회 중탕한 후 13,000 rpm에서 10분간 원심분리하여 얻어진 상층액을 검체로 사용하였다. 중성지방의 함량은 아산제약(Seoul, Korea)의 TG kit (AM157S)를 사용하여 분석하였다. 간 조직 내 중성지방 함량은 BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA)로 단백질량을 정량하여 단백질 농도에 따라 계산하였다.

4. Western blot

간 조직 내 단백질은 protease inhibitor, phosphatase inhibitor (Millipore, Burlington, MA, USA)를 포함한 RIPA lysis buffer (Thermo Fisher Scientific)를 사용하여 분리하였다. BCA protein assay를 이용하여 분리한 단백질을 정량하고 단백질 양이 동일하도록 검체를 제작하였다. 20 μg의 단백질을 sodium dodecyl sulfate-polyacrylamide gel에 분주하고 전기영동시켜 분리하였다. Gel 내부에 크기별로 분리된 단백질은 polyvinylidene fluoride membrane (GE Healthcare Life Sciences, Buckinghamshire, UK)에 이동시켰다. 각각의 membrane은 5%의 skim milk (BD Difco; BD, Franklin Lakes, NJ, USA)를 사용하여 2시간 동안 블로킹하였고, 1차 항체는 1μg/mL를 1:2,000으로 희석하여 4℃에서 밤새 반응시켰다. 이 때 사용한 항체 중 β-actin antibody, SREBP-1 antibody는 Santa Cruz Biotechnology (Dallas, TX, USA)로부터 구입하였고 FAS antibody, ACC antibody는 Cell Signaling Technology (Danvers, MA, USA)에서 구입하였다. 2차 항체는 1:2,000으로 희석하여 실온에서 1시간 동안 반응시키고 ECL kit (Millipore)와 image analyzer (EZ-Capture ST; ATTO Corporation, Tokyo, Japan)를 사용하여 단백질 발현량을 확인하였다. 이때 사용한 2차 항체로 사용한 Goat Anti- Mouse IgG H&L (HRP), Goat Anti-Rabbit IgG H&L (HRP)는 Abcam (Cambridge, UK)에서 구입하였다. 단백질 발현량은 Image J software (U.S. National Institutes of Health, Bethesda,, MD, USA)를 이용하여 β-actin 및 정상식이군을 기준으로 비교하였다.

5. Total RNA 분리 및 real time polymerase chain reaction (PCR)

간 조직 내 RNA는 TRIzol reagent (Invitrogen, Carlsbad, CA, USA)를 이용하여 분리하였고, 분광광도계(Implen GmbH, München, Germany)에서 흡광도를 측정하여 정량하였다. RNA로부터의 cDNA 합성은 1 μg total RNA와 Prime Script reagent kit (Takara, Tokyo, Japan)을 이용하여 진행하였다. Real time PCR은 cDNA, primer sequences (Table III), Power SYBR Green PCR master Mix (Applied Biosystems, Foster City, CA, USA)를 이용하여 수행하였다. 발현된 각각 유전자의 messenger RNA (mRNA) 양은 real-time PCR systems (Applied Biosystems)를 이용하여 glyceraldehyde-3-phosphate dehydrogenase에 대한 상대적인 양으로 계산하였다.

Table Ⅲ. Sequences and Accession Numbers for Primer, Forward and Reverse, Used in Real-Time PCR.

Gene Prime sequence (5’ → 3’) Accession No.
GAPDH Forward: CGTCCCGTAGACAAAATGGT NM_008084
Reverse: TTGATGGCAACAATCTCCAC
PPAR-γ Forward: GTACTGTCGGTTTCAGAAGTGCC NM_011146.4
Reverse: ATCTCCGCCAACAGCTTCTCCT
C/EBP-α Forward: GCGAGCACGAGACGTCTATAGA NM_001287514.1
Reverse: GCCAGGAACTCGTCGTTGAA

PCR: polymerase chain reaction, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, PPAR-γ: peroxisome proliferator-activated receptor γ, C/EBP-α: CCAAT/enhancer binding protein α..



6. 혈청 인슐린 농도 측정

혈청 내 인슐린 농도는 ALPCO Diagnostics (ALPCO, Salem, NH, USA)의 mouse ultrasensitive insulin ELISA kit (80-INSMSU)를 사용하여 제조사의 방법에 따라 측정하였다.

7. 통계 처리

모든 실험 결과는 평균±표준편차로 표기하였다. 각 군 간의 통계적 유의성 검정에 따른 통계분석은 one-way analysis of variance test Ducan 사후 검정 비교를 실시하여 p<0.05일 때 유의한 것으로 판정하였다. 통계분석에는 SPSS program for windows version 12 (SPSS Inc, Chicago, IL, USA)를 이용하였다.

결과»»»

1. 체중의 변화

주 1회 체중을 측정하여 체중의 변화를 비교하였다(Fig. 1). 5주 후 정상식이군의 체중은 23.83±1.23 g에서 28.06±1.07 g으로 증가하였고, 고지방식이군의 체중은 24.50±0.68 g에서 40.40±2.78 g으로 증가하여 정상식이군의 체중 변화와 비교하였을 때 유의하게(p<0.001) 증가하였다. 천마 추출물 100 mg/kg 투여군의 체중은 24.25± 0.69 g에서 33.76±3.02 g으로 증가, 천마 추출물 200 mg/kg 투여군의 체중은 24.22±0.61 g에서 33.18±1.61 g으로 증가, 천마 추출물 500 mg/kg 투여군의 체중은 24.28±1.24 g에서 32.63±2.17 g으로 증가하여 고지방식이군의 체중 변화와 비교하였을 때 고지방식이에 의한 체중 증가가 유의하게(p<0.001) 억제되었다.

Fig. 1. Effect of GEE on body weight in HFD-fed mice. GEE: Gastrodia elata extract, HFD: high fat diet, wk: week, ND: normal diet. ***p<0.001 vs. ND group, ###p<0.001 vs. HFD group. n=10.

2. 간 조직과 지방 조직 무게의 변화

적출한 간 조직과 부고환 지방 조직의 무게를 측정하여 비교하였다(Fig. 2). 고지방식이군의 간 조직 무게는 1.46±0.15 g으로 1.12±0.16 g인 정상식이군의 간 조직 무게와 비교하였을 때 유의하게(p<0.01) 증가하였으나 천마 추출물 100 mg/kg, 200 mg/kg, 500 mg/kg 투여군의 간 조직의 무게는 각각 1.13±0.16 g, 1.06±0.15 g, 1.14± 0.61 g으로 고지방식이군 대비 간 조직의 무게 증가가 유의하게(p<0.01, p<0.01, p<0.05) 억제되었다(Fig. 2A).

Fig. 2. Effect of GEE on the liver (A) and epididymal fat (B) weights in HFD-fed mice. GEE: Gastrodia elata extract, HFD: high fat diet, ND: normal diet. *p<0.05, ***p<0.001 vs. ND group, #p<0.05, ##p<0.01 vs. HFD group. n=10.

고지방식이군의 부고환 지방 조직의 무게는 2.06± 0.25 g으로 0.41±0.09 g인 정상식이군의 부고환 지방 조직 무게와 비교하였을 때 유의하게(p<0.001) 증가하였으나, 천마 추출물 100 mg/kg, 200 mg/kg, 500 mg/kg 투여군의 부고환 지방 조직의 무게는 각각 1.45±0.36 g, 1.45±0.17 g, 1.37±0.33 g으로 고지방식이군 대비 부고환 지방 조직의 무게 증가가 유의하게(p<0.05, p<0.05, p< 0.01) 억제되었다(Fig. 2B).

3. 중성지방 농도의 변화

혈청과 간 조직 내 중성지방(triglyceride) 농도를 측정하여 비교하였다(Fig. 3). 고지방식이군의 혈청 내 중성지방 농도는 176.10 mg/dL으로 정상식이군의 혈청 내 중성지방 농도 59.63 mg/dL와 비교하였을 때 2.95배가 증가하였으나(p<0.001), 천마 추출물 500 mg/kg 투여군의 혈청 내 중성지방 농도는 113.20 mg/dL로 고지방식이로 인한 혈청 내 중성지방 농도 증가를 유의하게 억제시킨 것으로 나타났다(p<0.01). 한편, 천마 추출물 100, 200 mg/kg 투여군의 혈청 내 중성지방 농도는 128.20 mg/dL, 132.50 mg/dL로 고지방식이군 대비 감소하였으나 유의한 값은 아니었다.

Fig. 3. Serum TG (A) and liver TG (B) levels in HFD-fed mice with effect of GEE. GEE: Gastrodia elata extract, HFD: high fat diet, TG: triglyceride, ND: normal diet. *p<0.05, ***p<0.001 vs. ND group, ##p<0.01 vs. HFD group. n=10.

고지방식이군의 간 조직 내 중성지방 농도는 58.58 mg/g protein으로 정상식이군의 간 조직 내 중성지방 농도 40.12 mg/g protein과 비교하였을 때 1.46배가 증가하였으나(p<0.05), 천마 추출물 100, 200, 500 mg/kg 투여군의 간 조직 내 중성지방 농도는 각각 48.19, 35.29, 38.49 mg/g protein으로 천마 추출물 200, 500 mg/kg 투여군에서 고지방식이로 인한 간 조직 내 중성지방 농도 증가를 유의하게 억제시킨 것으로 나타났다(p<0.01).

4. 비만 관련 유전자의 단백질 발현의 변화

고지방식이 유도 비만에 대한 천마 추출물의 효과 기전을 조사하기 위하여 SREBP-1, FAS, ACC의 단백질 발현량을 조사하였다. 그 결과 고지방식이를 섭취한 군의 SREBP-1, FAS, ACC 단백질 발현량은 정상식이군 대비 증가하였으나, 천마 추출물 100, 200, 500 mg/kg 투여군에서 SREBP-1, FAS, ACC의 단백질 발현량이 고지방식이 섭취군 대비 감소한 것을 살펴볼 수 있었다(Fig. 4).

Fig. 4. Effects of GEE on liver obesity-related protein expression in HFD-fed mice. SREBP-1, FAS, ACC protein expressions were determined by western blot analysis. GEE: Gastrodia elata extract, HFD: high fat diet, SREBP-1: sterol regulatory element-binding protein-1, FAS: fatty acid synthase, ACC: acetyl-CoA carboxylase.

5. 비만 관련 유전자의 mRNA 발현의 변화

고지방식이 유도 비만에 대한 천마 추출물의 효과 기전을 조사하기 위하여 PPAR-γ, C/EBP-α, ACC의 mRNA 발현량을 조사하였다. 그 결과 고지방식이를 섭취한 군의 PPAR-γ, C/EBP-α, ACC mRNA 발현량은 정상식이군 대비 유의하게 증가하는 것으로 나타났다(p<0.01, p<0.01, p<0.001). 한편, 천마 추출물 투여군에서 고지방식이 섭취군 대비 PPAR-γ의 mRNA 발현량이 농도 의존적으로 감소하였으며, 천마 추출물 200 mg/kg 투여군, 500 mg/kg 투여군에서 유의하게 감소(p<0.01, p<0.001)한 것으로 나타났다. 천마 추출물 투여군의 C/EBP-α mRNA 발현량에서도 고지방식이군 대비 감소하였으며, 특히 천마 추출물 500 mg/kg 투여군에서 유의한 결과(p<0.01)가 나타났다(Fig. 5).

Fig. 5. Effect of Gastrodia elata extract (GEE) on Hepatic mRNA expression level of obesity-related gene in high fat diet (HFD)-fed mice. Hepatic mRNA expressions were determined by Real-time PCR analysis. (A) Quantitative analysis of PPAR-γ mRNA expression (B) Quantitative analysis of C/EBP-α mRNA expression. **p<0.01 vs. ND group, #p<0.05, ##p<0.01, ###p<0.001 vs. HFD group. n=10.

6. 혈청 인슐린의 농도 변화

혈청 내 인슐린 농도(Fig. 6)를 측정하여 비교하였다. 고지방식이군의 혈청 내 인슐린 농도는 2.96 ng/mL으로 정상식이군의 혈청 내 인슐린 농도 0.56 ng/mL와 비교하였을 때 약 5배가 증가하였으나(p<0.01), 천마 추출물 500 mg/kg 투여군의 혈청 내 인슐린 농도는 1.29 ng/mL로 고지방식이로 인한 혈청 내 인슐린 농도 증가를 유의하게 억제시킨 것으로 나타났다(p<0.05). 한편, 천마 추출물 100, 200 mg/kg 투여군의 혈청 내 인슐린 농도는 1.98 ng/mL, 2.03 ng/mL로 고지방식이군 대비 감소하였으나 유의한 값은 아니었다.

Fig. 6. Serum insulin levels in HFD-fed mice with effect of GEE. GEE: Gastrodia elata extract, HFD: high fat diet, ND: normal diet. **p<0.01 vs. ND group, #p<0.05 vs. HFD group. n=10.
고찰»»»

천마는 임상에서 정신신경질환에 많이 쓰이고 있으며, 실험적으로 신경보호 및 항치매 효과가 보고되었다10,11). 비만은 고지혈증, 관상동맥 질환 등 다양한 만성 대사성 질환을 유발하는 것으로 알려져 있으며15), 만성 비만은 알츠하이머, 치매 등 다양한 만성 대사성 뇌 질환과 관련이 있다.

Fig. 1에서 천마 추출물을 투여한 군의 체중은 고지방 사료를 투여한 군과 비교하여 유의하게 감소하였다. 100, 200, 500 mg/kg 천마 추출물을 투여한 군에서 용량 의존성은 나타나지 않았으나 모든 군에서 유의한 감소 효과를 나타냈다. 이러한 천마 추출물의 고지방 사료에 의한 체중증가 억제 효과는 간과 부고환 주위 지방 무게의 감소와 관련이 있었다(Fig. 2). 비만의 혈액학적 지표 중 간과 혈액 내 중성지방의 증가 현상은 대부분 동반되는 것으로 알려져 있다. 본 실험에서 고지방 사료를 투여한 군의 간과 혈액 내 중성지방은 정상 사료를 투여한 군과 비교하여 유의하게 증가하였다(Fig. 3). 그러나 천마 추출물을 투여한 군은 고지방 사료에 의한 간과 혈액 내 중성지방의 증가를 유의하게 억제하였다(Fig. 3). 위의 결과들은 천마 추출물이 비만 효과가 있으며 그 기전에 간에서 중성지방의 합성과 관련이 있음을 의미한다. 간에서 중성지방의 합성과 관련된 유전자는 FAS, ACC로 알려져 있으며 이 유전자의 발현을 조절하는 전사인자(transcription factor)는 SREBP-1로 알려져 있다16). Fig. 4에서 보여주듯이 고지방 사료의 투여는 중성지방 합성 관련 유전자인 SREBP-1, FAS, ACC의 발현을 증가시켰다. 그러나 천마 추출물을 투여한 군에서 ACC의 발현이 유의하게 감소하였으나 FAS 발현은 감소하지 않았다. 또한 SREBP-1의 발현도 천마 추출물을 투여한 군에서 감소하였다. 이러한 결과는 천마 추출의 항비만 효과가 간에서 중성지방 합성의 감소와 관련 있으며, 그 기전에 중성지방 합성 관련 유전자인 ACC, SRRBP-1 발현의 감소가 관여함을 시사한다.

비만은 중성지방 합성 증가로 인해 지방세포 수가 증가하고, 지방세포 크기가 증가한다. 지방세포 분화의 증가로 지방세포 수가 증가하는데 필요한 유전자는 PPAR-γ와 C/EBP-α로 알려져 있다4,5). PPAR-γ는 지방세포 분화를 조절하는 master regulator로 PPAR-γ가 없으면 지방세포 분화가 일어나지 않으며4), C/EBP-α는 지방세포 분화 중기 이후에 발현하여 PPAR-γ의 발현을 유지시키는 역할을 하는 것으로 알려져 있다5). 고지방 사료의 투여는 지방세포의 분화에 관여하는 유전자인 PPAR-γ와 C/EBP-α mRNA 발현을 유의하게 증가시켰다(Fig. 5). 그러나 천마 추출물을 투여한 군에서는 고지방 사료에 의한 PPAR-γ와 C/EBP-α mRNA 발현의 증가를 유의하게 억제하였다(Fig. 5). 이러한 결과는 천마 추출물은 지방세포 분화를 억제하여 항비만 효과가 있음을 의미한다. 향후 3T3-L1, OP9 세포와 같은 in vitro 지방세포 분화 모델을 이용한 연구가 필요할 것으로 생각한다.

만성 비만은 인슐린 저항성을 증가시켜 제2형 당뇨 등 다양한 대사질환을 유발하는 것으로 알려져 있다13). Fig. 6에서 보여주듯이 고지방 사료 투여군에서 혈청 인슐린의 농도는 정상 사료를 투여한 군과 비교하여 유의하게 증가하여 인슐린 저항성을 나타냈다. 그러나 500 mg/kg 천마 추출물 투여군의 인슐린 농도는 고지방 사료를 투여군과 비교하여 유의하게 감소하였다(Fig. 6). 이러한 결과는 천마 추출물이 인슐린 농도를 감소키며 인슐린 저항성을 개선시킬 수 있음을 시사한다.

위 결과를 종합하면 천마 추출물은 고지방 사료에 의한 체중증가를 유의하게 억제하며 그 기전에 중성지방 합성 감소, 지방세포 분화 억제가 관여함을 나타낸다. 또한 향후 천마 추출물의 항비만 효과와 관련해서 보다 자세한 기전에 대한 추가 연구가 필요할 것으로 보인다.

결론»»»

본 연구를 통해 천마 추출물이 비만 동물 모델에서 체중 및 지방 무게의 증가를 억제한다는 점과 중성지방 및 그와 연관된 유전자 발현의 억제, 그리고 혈청 인슐린 농도의 증가를 억제한다는 점에서 향후 항비만 제제 개발의 후보물질이 될 수 있을 것으로 기대한다.

References
  1. The Society of Korean Medicine Rehabilitation. Korean Rehabilitation Medicine. 5th ed. Paju:Globooks. 2020:322-39.
  2. Ministry of Health and Welfare, Korea Disease Control and Prevention Agency. Korea health statistics [Internet]. 2019 [updated 2020 Dec 31; cited 2021 Nov 30].
    Available from: URL: http://www.index.go.kr/potal/main/EachDtlPageDetail.do?idx_cd=2705.
  3. Spiegelman BM, Flier JS. Adipogenesis and obesity: rounding out the big picture. Cell. 1996;87:377-89.
    Pubmed CrossRef
  4. Moseti D, Regassa A, Kim WK. Molecular regulation of adipogenesis and potential anti-adipogenic bioactive molecules. Int J Mol Sci. 2016;17(1):124.
    Pubmed KoreaMed CrossRef
  5. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, Spiegelman BM. C/EBPα induces adipogenesis through PPARγ: a unified pathway. Genes Dev. 2002;16(1):22-6.
    Pubmed KoreaMed CrossRef
  6. Rosen ED, MacDougald OA. Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol. 2006;7(12):885-96.
    Pubmed CrossRef
  7. Czech MP, Tencerova M, Pedersen DJ, Aouadi M. Insulin signalling mechanisms for triacylglycerol storage. Diabetologia. 2013;56(5):949-64.
    Pubmed KoreaMed CrossRef
  8. Kim HC. Herbal medicine pharmacology. Seoul:Jipmoondang. 2001:391-3.
    CrossRef
  9. Herbology Editorial Committee of Korean Medicine Schools. Boncho-hak [Herbology]. Seoul:Yeonglimsa. 1991:504-5.
    CrossRef
  10. Huang NK, Lin YL, Cheng JJ, Lai WL. Gastrodia elata prevents rat pheochromocytoma cells from serum-deprived apoptosis: the role of the MAPK family. Life Sci. 2004;75(13):1649-57.
    Pubmed CrossRef
  11. Wu CR, Hsieh MT, Huang SC, Peng WH, Chang YS, Chen CF. Effects of Gastrodia elata and its active constituents on scopolamine-induced amnesia in rats. Planta Medica. 1996;62(4):317-21.
    Pubmed CrossRef
  12. Sim KC. Effect of each Gastrodia elata Blume concentration on antidiabetic in diabetic mellitus rats. Korean J Orient Physiol Pathol. 2007;21:1477-82.
  13. Cho HH, Kwon DK, Kim JW, Song YJ. Effect of Salicornia herbacea L. supplementation on tissue triglyceride concentrations and PGC-1α & PPAR-γ expression of skeletal muscle of rats fed a high-fat diet. Journal of Life Science. 2018;28(7):857-63.
  14. Lee SJ, Kang MH, Min HS. Folic acid supplementation reduces oxidative stress and hepatic toxicity in rats treated chronically with ethanol. Nutrition Research and Practice. 2011;5(6):520-6.
    Pubmed KoreaMed CrossRef
  15. Korean Endocrine Society, Korean Society for the Study of Obesity. Management of obesity, 2010 recommendation. Endocrinol Metab. 2010;25(4):301-4.
    CrossRef
  16. Kersten S. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Reports. 2001;2(4):282-6.
    Pubmed KoreaMed CrossRef


October 2022, 32 (4)

Cited By Articles
  • CrossRef (0)

Funding Information

  • Crossref TDM
  • CrossMark
  • orcid