search for




 

J Korean Med Rehabi 2023 Jul; 33(3): 33-46  https://doi.org/10.18325/jkmr.2023.33.3.33
Anti-Obesity Effects of Menthae Herba Hydrosol on High-Fat Diet Induced Obese Mice
Published online July 31, 2023
Copyright © 2023 The Society of Korean Medicine Rehabilitation.

Soo-Min Choi, K.M.D.*, So-Young Kim, M.S., Young-Jun Kim, K.M.D.*, Chang-Hoon Woo, K.M.D.*, Mi-Ryeo Kim, Ph.D., Hee-Duk An, K.M.D.*

Departments of Korean Medicine Rehabiliation and Herbal Pharmacology, College of Korean Medicine, Daegu Haany University
Correspondence to: Hee-Duk An, Department of Korean Medicine Rehabilitation, College of Korean Medicine, Daegu Haany University, 136 Sincheondong-ro, Suseong-gu, Daegu 42158, Korea
TEL (053) 770-2116
FAX (053) 770-0566
E-mail okee@dhu.ac.kr
Received: June 20, 2023; Revised: July 3, 2023; Accepted: July 9, 2023
Abstract
Objectives We investigated anti-obesity effects of Menthae Herba hydrosol in obese mice.
Methods Animals were divided into four groups, and treatments were performed for 7 weeks. After the treatment, serum lipid profiles, weight and pathological morphology in liver, kidney, adipose tissue were measured. Also, hepatic protein and gene expression levels of lipid metabolism-related factors were analyzed.
Results Body weight was decreased in P3% group. In P1% (group fed high-fat diet and 1% Menthae Herba hydrosol) and P3% (group fed high-fat diet and 3% Menthae Herba hydrosol) group, weight of white adipose tissue, serum levels of triglyceride and blood urea nitrogen were decreased, and weight of muscle was increased. Also, liver, kidney and epididymal adipocyte size were reduced in P1% and P3% group. Adenosine monophosphate-activated protein kinase was increased and sterol regulatory element binding protein-1c (SREBP-1c) was decreased in P3% group. mPeroxisome proliferator-activator receptor-γ, mMonocyte chemotactic protein-1 were decreased in P1% and P3% group. In P3% group, mSREBP-1c was decreased and mCarnitine palmitoyl transferase-1 was increased. And mUncoupling protein 1 in brown adipose tissue was increased.
Conclusions These results suggest that Menthae Herba hydrosol has a worthy effect on anti-obesity.
Keywords : Mentae Herba, Hydrosol, Obesity, Adipose tissue, Lipid metabolism
서론»»»

비만은 지방세포의 비정상적인 증가로 체중이 증가된 상태를 말한다. 현재 그 유병률이 전 세계적으로 증가하고 있으며, 세계보건기구에서도 장기 치료가 필요한 질병으로 규정할 정도로 현재 심각한 사회⋅경제적인 건강 문제 중 하나이다1).

비만은 근본적으로 소모하는 열량보다 섭취되는 열량이 많아 체내에 지방이 축적되는 것인데, 이 외에도 유전적 소인, 내분비적 원인, 약물 등 다양한 원인으로 발생한다. 또한 현대화된 사회에서 운동 시간의 부족, 정신적 스트레스를 해소하기 위한 섭식장애 발생 등이 사회적인 문제로도 야기되고 있다2).

비만의 의학적 치료는 생활 방식 치료, 약물적 치료, 수술적 치료로 나눠볼 수 있다3). 이 중 식이습관의 교정 및 운동량 증가를 통한 체중 감량이 우선적으로 권장되며, 심각한 유병 질환을 동반하는 중증 비만에서는 약물 혹은 수술적 치료도 고려해야 한다3,4).

그동안 여러 약물들이 비만 치료에 사용되었지만 안전하고 장기간 사용이 가능한 비만 치료제를 찾기는 쉽지 않았다. Sibutramine은 심혈관질환의 부작용을 일으켜 사용이 중단되었고, 최근 많이 사용되는 phentermine, orlistat, naltrexone/bupropion 또한 다양한 부작용들을 가지고 있다4,5).

또한 수술적 치료를 받았을 때 후유증이 발생하는 경우도 10%가량 되어 안전한 치료법이라고 보기엔 무리가 있다6). 따라서 안전성이 확보된 천연물을 사용한 항비만 약물에 대한 탐색 연구가 다양하게 진행되고 있다7).

한의학에서 비만의 원인으로는 穀氣勝元氣, 脾胃俱旺, 脾胃俱虛, 痰飮, 氣虛, 血實氣虛, 數食甘味와 膏粱厚味 등이 있으며8), 국내에서는 1997년 대한한방비만학회가 창립된 이후로 비만에 관한 연구가 꾸준히 이루어지고 있다. 최근 연구에서 많이 사용되는 처방으로는 太陰調胃湯, 防風通聖散, 凉膈散火湯 등이 있고, 개별 단미로 연구된 본초는 人蔘, 鬱金, 麻黃, 薏苡仁 등이 있다9).

薄荷는 꿀풀과에 속한 多年生 本草로, 發散風熱藥에 분류된다. 薄荷 (Mentha arvensis Linne var. piperascens Malinvaud ex Holmes)의 지상부를 약으로 쓰며, 잎에는 1~1.5%의 정유를 함유하고 있으며, 정유 중 menthol 함량이 62~87%로 가장 많다. 性은 冷하고, 味는 辛하며, 宣散風熱, 淸頭目, 透疹의 효능을 지닌다10).

최근 薄荷에 관한 국내 연구에서 스트레스 완화 효과11), 항염증 효과12), 항산화 효과13), 인지 및 기억력 손상 개선 효과14)가 보고되었다. 국외에서는 薄荷의 지질대사 개선 효과15)를 밝힌 연구 및 薄荷의 주된 정유 성분인 menthol의 항비만 효과를 밝힌 연구16,17)가 있다. 또한 薄荷 hydrosol의 항진균 효과18)에 관한 연구는 있지만 항비만 효과를 다룬 연구는 아직까지 없다. 이에 저자는 薄荷의 정유 추출 과정에서 얻어진 hydrosol을 음용했을 때 지방 대사에 유의한 효과를 보인다면 제제의 다변화를 통한 薄荷의 임상 활용도가 제고될 것으로 생각하여 본 연구를 수행하였고, 고지방 식이로 비만 유도된 생쥐에 薄荷 hydrosol을 경구 투여하고 혈액생화학적 검사 및 조직의 지질 양상을 분석해 항비만 효능을 입증하고자 하였다. 이를 통해 유의한 결과를 얻었기에 보고하는 바이다.

재료 및 방법»»»

1. 재료 및 기기

1) 한약재 및 시약

본 실험에 사용된 薄荷는 동우당제약에서 구입하였다. 또한 isoflurane은 JW Pharmaceutical, 조직 염색에 사용한 formaldehyde, isopropyl alcohol은 Junsei Chemical 제품을 사용하였다. 세포 용해에 사용된 protease inhibitor 및 phosphatase inhibitor와 radioimmunoprecipitation assay (RIPA) buffer는 Thermo Fisher Scientific으로부터 구입하였다. 또한 western blot 분석 시약인 sodium dodecyl sulfate (SDS)는 BIO-RAD, peroxisome proliferator-activated receptor (PPAR)-α, PPAR-γ, CCAAT/enhancer-binding protein (C/EBP)-α, β-actin의 1차 항체는 Santa-Cruz Biotechnology, phospho-adenosine monophosphate-activated protein kinase (p-AMPK), AMPK, phospho-acetyl-CoA carboxylase (p-ACC), ACC의 1차 항체는 Cell Signaling으로부터 구입하였으며, 2차 항체는 GeneTex, ECL 시약은 GE Healthcare (AmershamTM)로부터 구매하였다.

2) 薄荷 hydrosol의 제조

薄荷 1 kg을 스팀 용량 100%, 가열 온도 100 ℃, 냉각기 온도 -1 ℃에서 소형오일추출기(EssenLab; Hanil Lab Tech)를 사용하여 1시간 30분간 수증기 증류법으로 추출하였다. 증류 추출된 薄荷油를 제외하고 하층의 증류액을 분취(수율 41.6%)하여 사용하였고, 분리된 薄荷 hydrosol을 1% 및 3%로 물에 희석하여 사용하였다.

3) 기체 크로마토그래피-질량분석계(gas chromatography-mass spectrometry [GC-MS])

薄荷 hydrosol에 함유된 유기화합물의 분석을 위해 GC-MS (Model 7890A & 5975C; Agilent)를 이용하였다. 또한 GC column은 HP-5MS (30×0.32 mm, 0.25 µm; Agilent)를 사용하였다. 오븐 온도는 50 °C에서 5분간 유지 후 250 °C까지 5 °C/min 속도로 승온하여 5분간 유지, 다시 300 °C까지 20 °C/min 속도로 승온하도록 설정하였으며, 주 injector 온도는 280 °C였다. MS의 이온화에너지는 70 eV였으며, 운반기체(헬륨)은 1분당 1 mL씩 흘려주었다. 각 화합물의 잠정적인 동정은 NIST library의 질량 스펙트럼 데이터에 의해 결정하였으며, 각 성분은 피크 면적과 내부표준물질을 이용하여 정량하였다.

4) 실험동물 및 실험군 설정

본 실험에서는 C57BL/6J (male, 5 weeks)를 ㈜중앙실험동물로부터 분양받아 1주간 적응기를 거친 다음 실험에 사용하였다. 실험은 대구한의대학교 동물실험윤리위원회의 승인(DHU2022-023)을 얻어, 동물 관리 규정에 따라 수행되었다. 실험동물은 대구한의대학교 동물사육실에서 일정한 조건(온도: 23±2 ℃, 상대습도 50±10%, 명암: 12시간 주기)을 유지하면서 사료와 음수의 자유로운 섭취가 가능하게 사육하였으며, 실험 시작 전까지 물과 먹이를 충분히 제공하였다. 적응 기간이 끝난 후 실험동물들을 난괴법에 따라 총 4개의 실험군(n=7)인 정상군(normal diet+tap water, NDW), 대조군(high-fat diet tap water, HFDW), 薄荷 hydrosol 1% 음용군(high-fat diet+1% Menthae Herba hydrosol, P1%), 薄荷 hydrosol 3% 음용군(high-fat diet+3% Menthae Herba hydrosol, P3%)으로 분류하고, 식이 및 시료를 공급하였다. 즉 NDW군은 정상 식이를 공급하였으며, HFDW군, P1% 및 P3%군에는 고지방 식이(45 kcal% high-fat diet)를 총 7주간 공급하여 비만을 유도하였다. 또한 NDW군과 HFDW군에는 아무것도 첨가하지 않은 상수(上水)를 음용시켰으며, 薄荷 hydrosol 1% 음용군(P1%), 薄荷 hydrosol 3% 음용군(P3%)에는 각각 1% 및 3%로 희석한 薄荷 hydrosol을 7주간 음용시켰다.

2. 방법

1) 식이조제 및 시료의 투여

본 실험에서 정상 식이 및 고지방 식이는 각각 AIN76A (D10001; Research Diets) 및 45 kcal% fat (D12451; Research Diets)을 사용하였으며, 식이 조성은 Table I과 같다. 각 군의 식이는 각각 10 g/cage를 분배하고 2일마다 먹은 양을 확인하였다.

Diet Composition for Animal Experiment.

Ingredient ND group HFD group
Main ingredient 100 100
Protein 20.8 20
Carbohydrate 67.7 35
Fat 11.5 45
Sub-ingredient 1,000 1,000
Casein (30 Mesh) 200 233.06
DL-Methionine 3 -
L-Cystine - 3.50
Corn Starch 150 84.83
Maltodextrin 10 - 116.53
Sucrose 500 206.02
Cellulose (BW 200) 50 -
Solka Floc (FCC 200) - 58.26
Soybean oil - 29.13
Lard - 206.84
Corn oil 50 -
Mineral Mix S10026B - 58.26
Mineral Mix S10001 35
Vitamin Mix V10001C 10 1.17
Choline bitartrate 2 2.33
FD&C Red Dye #40 - 0.06

ND: normal diet (AIN76A diet), HFD: high-fat diet (Rodent Diet with 45 kcal% fat)..



체중 및 식이섭취량(food intake)은 실험 시작일로부터 2일에 한 번씩 일정 시간에 측정하였으며, 음수량은 매일 일정한 시간에 1일 1회 7주간 측정하였다. 식이효율(food efficiency ratio, FER)은 {체중 증가량(g)/식이 섭취량(g)}×100으로 계산하여 산출하였다.

2) 장기 무게 측정 및 조직 분리

실험동물은 희생 전 12시간 절식시키고, isoflurane으로 흡입시켜 마취시킨 다음, 심장으로부터 혈액을 채취한 후 4 ℃, 3,000 rpm에서 15분간 원심 분리하여 혈청을 분리하였다. 실험동물로부터 간, 신장, 근육(비복근, 가자미근) 및 지방조직(부고환 지방, 신장 주위 지방, 복부 피하 지방 및 갈색 지방[brown adipose tissue, BAT])을 즉시 적출하고 차가운 생리식염수에 수차례 세척하여 표면의 수분을 제거한 후 미세저울(XB 220A; Precisa)을 이용하여 칭량하였다. 일부 간, 신장 및 백색 지방(white adipose tissue, WAT), 부고환 지방은 조직 관찰을 위해 5% formalin 용액에 고정시킨 후 분석에 사용하였으며, 다른 일부 간 및 BAT는 western blot 및 중합효소연쇄반응(polymerase chain reaction, PCR) 분석을 위해 -80 °C에 보관 후 실험 분석에 사용하였다.

3) 혈액생화학적 지표 분석

혈청에서 간 기능 지표인 aspartate aminotransferase (AST), alanine aminotransferase (ALT)와 중성지질(triglyceride, TG), 총 콜레스테롤(total-cholesterol, TC), high-density lipoprotein cholesterol (HDL-C), glucose 및 혈중요소질소(blood urea nitrogen, BUN)의 농도를 혈액자동분석기(Vet test 8008; IDEXX)를 이용하여 분석하였다. 또한 low-density lipoprotein cholesterol (LDL-C) 및 동맥경화지수(atherogenic index, AI)는 다음 공식에 의해 계산되었다.

LDL=([TC]-[HDL-C])-[TG/5]

AI=([TC]-[HDL-C])/[HDL-C]

4) 조직병리학적 양상 분석

간, 신장 및 부고환 지방조직을 cold phosphate buffer saline로 수세한 후 5% formalin 용액에 24시간 담가 고정하고, 파라핀 포매 과정 후 microtome (CR-603; Jinhua Craftek Instrument)을 이용하여 3 µm 두께로 박절하여 조직 슬라이드를 제작하였다. 각 조직의 H&E 염색을 위해 조직 슬라이드를 hematoxylin으로 5분간 염색한 다음, eosin으로 2~3분간 염색한 후 탈수과정을 거쳐 mounting 과정을 시행하였고, 광학현미경(M5000; Thermo Fisher Scientific)을 이용하여 조직학적 변화를 관찰하였다. 모든 사진은 200배에서 관찰하였다.

5) 간의 지방 대사 관련 단백질 발현 분석

실험동물에서 적출한 간 조직 0.1 g에 protease inhibitor를 첨가한 RIPA buffer (20 μM Tris pH 7.2, 20 mM Sucrose, 1 mM EDTA, 1 mM DTT, 10 mM KCl, 1.5 mM MgCl2, 5 µg/mL pepstatin A, 10 µg/mL leupeptin, 2 µg/mL aprotinin) 1 mL를 넣어 균질화시킨 다음, 13,000 rpm, 4 ℃에서 30분간 원심 분리하여 상층액을 분리하였다. 분리한 추출액을 Bradford 법19)을 이용하여 단백질량을 정량하였다. 정량된 단백질 24 µg을 10~12% SDS (BIO-RAD)-polyacrylamide gel electrophoresis에서 전기영동으로 단백질을 분리한 후, polyvinylidene difluoride membrane으로 이동시킨 뒤 membrane을 Tris Buffered Saline Buffer with Tween 20 (TBST)로 용해한 5% bovine serum albumin으로 1시간 동안 blocking을 실시하였다. 연이어 sterol regulatory element binding protein-1 (SREBP-1), PPAR-γ, p-ACC, ACC, p-AMPK, AMPK (1:1,000; dilution, Cell Signaling), HMG-CoA (1:1,000; dilution, Santa-Cruz Biotechnology), carnitine palmitoyl transferase-1 (CPT-1; 1:1,000; dilution, Abcam) 및 β-actin (1:3,000; dilution, Santa-Cruz Biotechnology) 등의 항체들을 각각 처리하여 overnight 동안 4 ℃에서 반응시켰다. TBST로 세척한 후 1차 항체에 알맞은 2차 항체로 실온에서 1시간 동안 처리하여 다시 TBST 세척 후 ECL detection 시약(Super signal west pico plus chemiluminescent substrate; Thermo Fisher Scientific)으로 처리 후 Chemidoc system (Alliance Q9 Mini; UVITEC)을 이용해 western band를 확인하였으며, Image J 프로그램을 사용하여 정량하였다.

6) 지방 대사 관련 유전자 발현 분석

(1) Total RNA 추출

Total RNA는 실험동물에서 적출한 간 및 BAT를 Trizol Reagent (TRIzolTM Reagent; Invitrogen)를 이용하여 추출하였다. 조직 0.1 g에 Trizol Reagent를 500 µL를 넣어 grinder로 균질화시킨 다음, 1-bromo-3-chloropropane (BCP; Molecular Research Center) 50 µL를 넣고 실온에 15분간 방치 후 13,000 rpm, 4 ℃에서 15분간 원심 분리하여 상층액을 분리하였다. 분리한 추출액에 isopropyl alcohol (2-propanol; Sigma)을 추출액과 동량을 넣어준 후 실온에서 10분 방치한 후 15,000 rpm, 4 ℃에서 15분간 원심 분리하여 상층액을 제거하였다. 80% EtOH로 RNA 침전물을 세척하고 완전히 건조한 후 DEPC-water (UltraPureTM DNase/RNase-Free Distilled Water; Invitrogen)로 녹여 정량화를 하였다.

(2) 역전사 중합효소연쇄반응(real-time PCR)

cDNA 합성을 위한 역전사 반응(reverse transcription)은 Reverse Transcriptase (A2791 GoScriptTM Reverse Transcription Mix, Oligo [dT]; Promega)를 이용하였다. Total RNA 1 µg을 70 ℃에서 5분간 denaturation한 후, GoScriptTM Reaction Buffer and Oligo (dT) Mix 4 µL, GoScriptTM Enzyme Mix 2 µL 및 DEPC-water를 넣어 최종 20 µL로 맞추고 Thermal cycler (T100; Biorad Co., Ltd.)에서 42 ℃로 1시간 동안 반응시켜 cDNA를 합성하였다. 합성된 cDNA는 DEPC-water 80 µL와 혼합하여 -20 ℃에 보관하였다.

실시간 중합효소연쇄반응(real-time PCR)은 power SYBR® green pcr master mix (4367659; Thermo Fisher Scientific)를 이용하였다. cDNA 2 µL, primer 각각 1 µL, SYBR master Mix 10 µL, DEPC-water를 넣어 최종 20 µL가 되도록 맞춘 후에 real-time PCR machine (QuantStudio 3 real-time PCR Instrument; Thermo Fisher Scientific)을 이용하여 cDNA를 증폭하고 형광량을 분석하였다. 유전자를 증폭시키기 위한 반응 조건은 95 °C에서 3분간 유지, 이후 95 °C에서 30초, 60 °C에서 30초, 72 °C에서 30초간 40 cycles를 반복하여 Threshold cycle (Ct) 값을 측정하였다. 유전자의 발현량은 house keeping 유전자인 ribosomal protein L32 (RPL32)를 사용하여 normalization 시킨 후, 2-ΔΔCt 방법(comparative Ct method)20)을 이용하여 분석하였다(Table II).

Sequences of Primers for Real-Time Polymerase Chain Reaction.

Gene Forward (5′-3′) Reverse (5′-3′)
RPL32 AACCCAGAGGCATTGACAAC CACCTCCAGCTCCTTGACAT
TBP CAGCCTTCCACCTTATGCTC TTGCTGCTGCTGTCTTTGTT
SREBP-1c GTGAGCCTGACAAGCAATCA GGTGCCTACAGAGCAAGAG
C/EBP-α TTGTTTGGCTTTATCTCGGC CCAAGAAGTCGGTGGACAAG
MCP-1 ACTGAAGCCAGCTCTCTCTTCCTC TTCCTTCTTGGGGTCAGCACAGAC
HMGCR TGTTCACCGGCAACAACAAGA CCGCGTTATCGTCAGGATGA
PPAR-γ ATCGAGGACATCCAAGAC CAATCTGCCTGAGGTCTG
CPT-1α TCATTGGCCACCAGTTCCATTA CCAATGGCTGCCACACTCTC
UCP-1 CAAAAACAGAAGGATTGCCGAAA TCTTGGACTGAGTCGTAGAGG

결과»»»

1. 薄荷 hydrosol의 방향성 화합물 분석

薄荷 hydrosol에 함유된 유기화합물의 성분을 GC-MS를 이용하여 측정한 결과는 Fig. 1과 같다. 3.743분에서 검출된 피크는 용매인 MeOH이며, 薄荷 hydrosol에서 薄荷의 주성분인 menthol은 26.390분에서 피크가 검출되었으며, 83.20%로 가장 많은 함량을 나타내었다. 또 다른 주성분인 menthone은 18.976분에서 피크가 검출되었으며, 함량은 5.94%로 나타났다(Table III).

Fig. 1. Gas chromatography-mass spectrometry chromatogram of Menthae Herba hydrosol. The number on the horizontal axis means the retention time of the peak.

Chemical Profiles of Menthae Herba Hydrosol by Gas Chromatography-Mass Spectrometry.

No. Name RT Area%
1 MeOH 3.743 -
2 Unknown compound 16.399 4.31
3 Unknown compound 18.407 6.55
4 Menthone 18.976 5.94
5 Menthol 26.390 83.20
Total (%) 100

RT: retention time, Area%: relative peak area percentage (peak area relative to the total peak area %)..



2. 체중, 식이섭취량 및 FER에 미치는 영향

1주 후 NDW군보다 HFDW군의 체중이 유의하게 증가하였으며, 薄荷 hydrosol 음용 5주 이후 HFDW군보다 P3%군에서 유의한 체중 감소를 보였다. 음용 7주 후 체중은 HFDW군에 비해 NDW군과 P3%군에서 유의하게 감소되었다(Table IV, Fig. 2). HFDW군에 비해 P1% 및 P3%군에서 식이 섭취량이 감소되는 경향을 보였고, FER은 NDW군에 비해 HFDW군, P1% 및 P3%군에서 유의하게 높게 나타났다(Table IV).

Fig. 2. Effect of Menthae Herba hydrosol on body weight change in high-fat diet fed mice. Data are presented as mean±standard deviation (n=7). NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol. abcMeans not sharing a common letter are significantly different among the groups at p<0.05.

Effect of Menthae Herba Hydrosol on Body Weight, Food Intake, Caloric Intake and FER in High-Fat Diet Fed Mice.

Item Group
NDW HFDW P1% P3%
Initial body weight (g) 20.20±0.23a 20.20±0.23a 20.20±0.34a 20.10±0.40a
Final body weight (g) 24.48±0.40a 34.37±1.15c 30.36±0.74bc 31.53±0.78b
Body weight gain (g/day) 0.13±0.02a 0.40±0.08c 0.35±0.06bc 0.32±0.07bc
Food intake (g/day) 2.74±0.13a 3.02±0.07a 2.79±0.04a 2.83±0.04a
FER 1.59±0.16a 4.48±0.49b 4.26±0.16b 3.96±0.38b

Values are presented as mean±standard deviation (n=7)..

FER: food efficiency ratio, NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol..

abcMeans not sharing a common letter are significantly different among the groups at p<0.05..



3. 음수량에 미치는 영향

1주에 NDW군에서 가장 높은 음수량을 보였으며 P1% 및 P3%군에서는 NDW군에 비해 유의하게 낮은 음수량을 보였으나 2주째부터는 모든 군에서 음수량의 큰 차이가 나타나지 않았다(Fig. 3).

Fig. 3. Effect of Menthae Herba hydrosol on water intake in high-fat diet fed mice. Data are presented as mean±standard deviation (n=7). NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol. abMeans not sharing a common letter are significantly different among the groups at p<0.05.

4. 장기 무게에 미치는 영향

총 WAT 무게는 HFDW군에 비해 P1% 및 P3%군에서 유의한 감소를 보였다(Table V).

Effect of Menthae Herba Hydrosol on WAT Weights in High-Fat Diet Fed Mice.

Group WAT weights (g/100 g bw)
Epididymal WAT Retroperitoneum WAT Perirenal WAT Mesenteic WAT Total WAT
NDW 1.55±0.42a 0.38±0.12a 0.18±0.02a 0.60±0.17a 2.71±0.66a
HFDW 4.76±0.43c 1.88±0.36c 0.63±0.12c 1.60±0.31c 8.86±1.04c
P1% 4.02±0.66b 1.58±0.08bc 0.57±0.10bc 1.31±0.22b 7.20±0.63b
P3% 4.13±0.81b 1.27±0.58b 0.50±0.07b 1.17±0.22b 6.75±1.33b

Values are presented as mean±standard deviation (n=7)..

WAT: white adipose tissue, bw: body weight, NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol..

abcMeans not sharing a common letter are significantly different among the groups at p<0.05..



장기 무게 중 간 무게는 NDW군에 비해 HFDW군에서 증가하였으나 유의하지 않았다. P1% 및 P3%군의 간 무게는 NDW군과 비슷한 수준으로 나타났다. 신장 무게는 NDW군에 비해 HFDW군, P1% 및 P3%군에서 유의하게 감소하였다. 비복근과 가자미근 총 무게는 HFDW군에 비해 P1% 및 P3%군에서 유의하게 증가하였다. BAT 무게는 NDW군에 비해 HFDW군, P1% 및 P3%군에서 유의하게 증가하였으나, 세 군 모두 비슷한 무게를 보였다(Table VI).

Effect of Menthae Herba Hydrosol on Tissue Weights in High-Fat Diet Fed Mice.

Group Tissue weight (g/100 g bw)
Liver Kidney Muscle BAT
NDW 2.81±0.41a 1.15±0.07b 1.23±0.06c 0.30±0.04a
HFDW 3.04±0.14a 1.07±0.07a 0.92±0.07a 0.35±0.03b
P1% 2.85±0.20a 1.05±0.08a 1.03±0.05b 0.35±0.04b
P3% 2.80±0.22a 1.00±0.10a 1.08±0.09b 0.35±0.04b

Values are presented as mean±standard deviation (n=7)..

bw: body weight, NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol, Muscle: gastrocnemius muscle and soleus muscle, BAT: brown adipose tissue..

abcMeans not sharing a common letter are significantly different among the groups at p<0.05..



5. 혈액생화학적 지표에 미치는 영향

AST 수치는 HFDW군에 비해 P3%군에서 감소하는 경향이 나타났으며, ALT 수치는 비슷한 수준으로 나타났다. Glucose 수치는 HFDW군에 비해 P1% 및 P3%군에서 감소하는 경향을 보였다. BUN 수치는 NDW군, HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다(Table VII).

Effect of Menthae Herba Hydrosol on Hematobiochemical Indices in High-Fat Diet Fed Mice.

Group Serum levels (mg/dL)
AST ALT Glucose BUN
NDW 146.75±51.76a 43.60±14.38a 179.20±54.04a 29.33±5.20b
HFDW 154.50±41.27a 45.67±2.18a 204.67±26.65a 30.29±1.81b
P1% 158.40±38.79a 45.86±17.81a 192.00±14.16a 24.43±1.81a
P3% 115.20±16.84a 45.50±7.15a 192.00±76.27a 24.00±4.53a

Values are presented as mean±standard deviation..

NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol, AST: aspartate aminotransferase, ALT: alanine aminotransferase, BUN: blood urea nitrogen..

abMeans not sharing a common letter are significantly different among the groups at p<0.05..



TG는 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였으며, TC 수치도 HFDW군에 비해 P1% 및 P3%군에서 감소하는 경향을 보였다. HDL-C 수치는 HFDW군에 비해 P3%군에서 유의하게 증가하였다. AI는 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다(Table VIII).

Effect of Menthae Herba Hydrosol on Serum Lipid Profiles in High-Fat Diet Fed Mice.

Group Serum levels (mg/dL)
TG TC HDL-C LDL-C AI
NDW 61.32±7.83a 137.20±19.84a 37.91±4.42a 82.01±22.34a 0.05±0.02a
HFDW 117.57±22.73c 146.67±12.10a 34.02±4.89a 91.03±10.88a 0.09±0.02b
P1% 92.45±19.01b 132.57±9.55a 40.26±6.03ab 72.98±11.36a 0.06±0.02a
P3% 70.29±13.40ab 128.75±45.24a 45.45±5.59b 91.56±7.46a 0.04±0.01a

Values are presented as mean±standard deviation..

NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol, TG: triglyceride, TC: total cholesterol, HDL-C: high-density lipoprotein cholesterol, LDL-C: low-density lipoprotein cholesterol, AI: atherogenic index= [TC]-[HDL-C]/[HDL-C]..

abcMeans not sharing a common letter are significantly different among the groups at p<0.05..



6. 조직병리학적 양상에 미치는 영향

간 조직에서 고지방 식이(HFD) 공급에 의해 간 소엽 전반에 걸쳐 간세포의 비대와 공포화를 특징으로 하는 지방 변화(fatty changes) 소견이 발견되었다. 한편 P1% 및 P3%군에서는 간세포의 크기 감소 및 규칙적인 배열이 관찰되었다. 신장 조직에서는 고지방 식이(HFD) 공급에 의해 사구체의 비대가 관찰되었고, P1% 및 P3%군에서 사구체의 크기 감소를 보였다. 또한 부고환 지방조직에서도 NDW군에 비해 HFDW군에서 지방구의 크기 및 지방의 축적이 증가되었다. P1% 및 P3%군에서는 조직 내 지방구의 크기뿐만 아니라 지방 축적 정도가 HFDW군에 비해 감소한 것으로 관찰되었다(Fig. 4).

Fig. 4. Effect of Menthae Herba hydrosol on histomorphology of liver, kidney glomerulus and epididymal WAT in high-fat diet fed mice (original magnification ×200). Arrows indicate change of adipocyte size and distribution. NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol, WAT: white adipose tissue.

7. 간의 지방 대사 관련 단백질 발현에 미치는 영향

AMPK 단백질의 인산화 수준을 조사한 결과, NDW군에 비해 HFDW군에서 AMPK 인산화는 비슷한 수준으로 나타났으며, P3%군에서 HFDW군에 비해 AMPK의 인산화가 유의하게 증가하였다. ACC의 인산화는 NDW군에 비해 HFDW군에서 약간 증가하였으며, HFDW군에 비해 P1% 및 P3%군에서 ACC의 인산화가 증가하는 경향을 보였으나 유의하지 않았고, P3%군에서 NDW군에 비해 ACC의 인산화가 유의하게 증가하였다.

PPAR-γ의 단백질 발현은 NDW군에 비해 HFDW군에서 유의하게 증가하였으며, HFDW군에 비해 P3%군에서 PPAR-γ의 발현이 감소하는 경향을 보였다. SREBP-1c의 단백질 발현을 분석한 결과, NDW군에 비해 HFDW군에서 유의하게 증가하였고, P1%군에서는 HFDW군에 비해 약간 감소하는 경향이 나타났으며, P3%군에서는 HFDW군에 비해 유의하게 감소하였다. CPT-1의 단백질 발현은 NDW군에 비해 P1% 및 P3%군에서 유의하게 증가하였다. 반면에 HMGCR의 단백질 발현은 HFDW군에 비해 P1% 및 P3%군에서 감소하는 경향을 보였다(Fig. 5).

Fig. 5. Effect of Menthae Herba hydrosol on lipid-related protein expressions of liver in high-fat diet fed mice. Data are presented as mean±standard deviation (n=7). (A) Phospho-adenosine monophosphate-activated protein kinase (p-AMPK). (B) Phospho-acetyl-CoA carboxylase (p-ACC). (C) Peroxisome proliferator-activator receptor-γ (PPAR-γ). (D) Sterol regulatory element binding protein-1c (SREBP-1c). (E) Carnitine palmitoyl transferase-1 (CPT-1). (F) HMG-CoA reductase. NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol. abcMeans not sharing a common letter are significantly different among the groups at p<0.05.

8. 간의 지방 대사 관련 유전자 발현에 미치는 영향

mSREBP-1c의 발현을 분석한 결과, NDW군에 비해 HFDW군에서 유의하게 증가하였으며, P3%군에서는 HFDW군에 비해 유의하게 감소하였다. mC/EBP-α와 mMonocyte chemotactic protein-1 (mMCP-1) 발현은 각각 NDW군에 비해 HFDW군에서 유의하게 증가하였다. P1% 및 P3%군에서 mC/EBP-α 발현은 HFDW군에 비해 감소하는 경향을 보였으며, mMCP-1 발현은 유의하게 감소하였다. mPPAR-γ 발현은 NDW군에 비해 HFDW군에서 유의하게 증가하였고, HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다. mCPT-1의 발현은 HFDW군에 비해 P3%군에서 유의하게 증가하였다. 또한 mHMGCR 발현은 NDW군에 비해 HFDW군에서 유의하게 증가하였으며, P1% 및 P3%군에서는 HFDW군에 비해 유의하게 감소하였다(Fig. 6).

Fig. 6. Effect of Menthae Herba hydrosol on lipid metabolism-related gene expressions of liver in high-fat diet fed mice. Data are presented as mean±standard deviation (n=7). (A) mSterol regulatory element binding protein-1c (mSREBP-1c). (B) mCCAAT enhancer-binding protein-α (mC/EBP-α). (C) mMonocyte chemotactic protein-1 (mMCP-1). (D) mPeroxisome proliferator-activator receptor-γ (mPPAR-γ). (E) mCarnitine palmitoyl transferase-1 (mCPT-1). (F) mHMG-CoA reductase. NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol. abcMeans not sharing a common letter are significantly different among the groups at p<0.05.

9. BAT의 uncoupling protein 1 (UCP-1) 및 PPAR-γ 유전자 발현에 미치는 영향

BAT에서 mUCP-1 발현을 분석한 결과, NDW군에 비해 P1% 및 P3%군에서 유의하게 증가하였으며, HFDW군에 비해 P3%군에서 유의하게 증가하였다. 한편, mPPAR-γ 발현은 HFDW군에 비해 P1% 및 P3%군에서 감소하는 경향을 보였다(Fig. 7).

Fig. 7. Effect of Menthae Herba hydrosol on gene expressions of brown adipose tissue in high-fat diet fed mice. Data are presented as mean±standard deviation (n=7). mUCP: mUncoupling protein 1, mPPAR-γ: mPeroxisome proliferator-activator receptor-γ, NDW: group fed normal diet and tap water, HFDW: group fed high-fat diet and tap water, P1%: group fed high-fat diet and 1% Menthae Herba hydrosol, P3%: group fed high-fat diet and 3% Menthae Herba hydrosol. abcMeans not sharing a common letter are significantly different among the groups at p<0.05.
고찰»»»

비만은 선진국에서 가장 흔한 질환 중 하나로 최근 우리나라에서도 생활수준 향상과 식생활의 서구화에 의해 유병률이 증가하고 있다4). 비만은 고혈압, 당뇨병, 고지혈증, 심혈관계 질환 등 다양한 성인병을 유발하며 사망률 또한 증가시킨다21). 따라서 최근 비만의 예방 및 치료에 대한 관심이 높아지고 있으며, 다양한 비만 치료제와 기능성 식품 소재의 항비만 효과를 평가하기 위해 식이성 비만 모델을 이용한 연구들이 활발히 진행되고 있다22).

薄荷 (M. arvensis)는 아시아가 원산지인 다년생 초본식물로, 현재 전 세계적으로 25종이 재배되고 있다. 薄荷는 고려 때는 방하(芳荷), 조선시대에는 영생(英生)으로 불렸으며, 소화불량, 감기, 두통 등에 자주 사용됐다. 薄荷의 잎은 menthol, isomenthone, menthofurane이 주성분으로 되어 있는데, 이 성분들의 독특한 풍미로 향신료, 방향제 등에도 많이 이용된다23,24). 또한 發散風熱, 淸頭目10)하는 薄荷의 효능을 이용하여 정유의 형태로 향기요법에서 사용되기도 한다. 코로 흡입하게 함으로써 후각을 통해 뇌의 신경계에 작용을 하게 하여 우울증, 불안 및 인지장애 등에 사용된다11).

Hydrosol은 수증기 증류법으로 향기요법에 쓰이는 식물체의 향기성분인 정유를 추출하는 과정에서 얻어지는 부산물로 플로랄 워터(floral water)라고 표현하기도 한다. 꽃 이외의 다른 부위에서도 정유 추출이 가능하므로 플로랄 워터보다는 hydrosol로 사용하는 것을 권장하는 편이다. 이 hydrosol에는 정유성분이 다량 함유되어 있어 의약품과 화장품 등 다양하게 활용될 수 있다25).

薄荷 hydrosol의 GC-MS 분석 결과, 薄荷 정유의 주성분에 관한 연구26,27)에서처럼 薄荷 hydrosol의 주요 성분이 menthol과 menthone이며, 함유량도 비슷함을 보여 주었다.

본 연구에서 薄荷 hydrosol 음용 7주 후 P3%군에서 체중이 유의하게 감소되었다. 또한 HFDW군에 비해 P1% 및 P3%군에서 식이 섭취량이 감소되는 경향을 보였다(Fig. 2, Table IV). 이는 薄荷 hydrosol이 단순히 체중뿐만 아니라 식이 섭취량에도 약간의 영향을 미친다는 것을 알 수 있다.

薄荷 hydrosol을 음용한 P1% 및 P3%군에서의 음수량은 첫 주에서만 유의하게 낮게 나타났으며, 2주째부터는 모든 군에서 큰 차이가 나타나지 않았다(Fig. 3). 이는 薄荷 hydrosol에 함유된 정유 성분의 향 때문으로 사료된다.

지방조직은 크게 WAT와 BAT으로 나뉜다. WAT의 경우 TG의 형태로 에너지를 저장하는 역할을 하며, BAT는 저장된 에너지를 열로써 소비하는 역할을 한다28). 본 연구에서 총 WAT 무게는 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다(Table V). BAT 무게는 NDW군에 비해 HFDW군, P1% 및 P3%군에서 유의하게 증가하였으나, 세 군 모두에서 비슷한 수치로 나타났다(Table VI). 따라서, 薄荷 hydrosol은 체내의 지방을 감소시키고, 그로 인해 장기의 무게들도 감소한 것으로 사료된다. 하지만 열로써 에너지를 소비시키는 BAT 전체의 무게는 감소시키지 않았다.

근육량은 활동량에 영향을 미쳐 비만 환자에게 아주 중요한 부분이다. 근육량이 부족할 경우 근육 안쪽으로 지방이 축적되고, 에너지 불균형을 일으켜 대사증후군을 유발하기도 한다29). 실험 결과, 비복근과 가자미근 총 무게는 HFDW군에 비해 P1% 및 P3%군에서 유의하게 증가하였다(Table VI). P1% 및 P3%군에서 정상군에 비해 근육량이 감소하였지만 회복 추세에 있으므로 장기 음용하면 근육량의 증가로 인한 체지방 감소 효과에 영향을 미칠 것으로 사료된다.

혈청 간 기능 지표와 지질 관련 지표들을 분석한 결과, BUN 수치는 NDW군, HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다(Table VII). 혈청 중 TG는 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다. HDL-C 수치는 HFDW군에 비해 P3%군에서 유의하게 증가하였고, AI는 P1% 및 P3%군에서 유의하게 감소하였다(Table VIII). 따라서 薄荷 hydrosol은 체내 지방의 감소뿐 아니라 혈청 내의 지질 관련 지표도 개선시키는 효과를 나타냈다.

고지방 식이(HFD) 섭취 후 간 소엽 전반에 걸쳐 간세포의 비대와 공포화를 특징으로 하는 지방 변화(fatty changes) 소견이 발견되었다. 하지만 P1% 및 P3%군에서는 간세포의 크기 감소 및 규칙적인 배열이 관찰되었다. 또한 HFDW군에서 나타난 신장 조직의 사구체 비대 양상이 P1% 및 P3%군에서는 개선되었다. 이 결과는 비만이 발생하면 호르몬과 혈액학적 영향으로 신장 조직의 손상을 유발하고 사구체 여과율을 증가시켜 사구체의 비대, 기저막 두께 증가 등 구조적 변화를 유발한다는 보고30)와 일치한다. 그리고 P1% 및 P3%군의 부고환 지방조직에서도 고지방 식이로 유도된 조직 내 지방구의 크기 및 축적이 감소한 것을 관찰하였다(Fig. 4). 조직병리학적 결과로 보아 薄荷 hydrosol 음용 후, 장기 무게가 감소한 것은 장기 내 지방세포 크기의 감소에 기인한다는 것을 알 수 있었다.

AMPK는 세포 내 에너지 항상성 유지를 위한 serine-threonine으로, 지방산의 합성과 분해에 모두 관여한다31). AMPK의 활성화는 ACC를 인산화시켜 지방세포 전사인자인 malonyl-CoA의 농도를 감소시키는 기전으로 지방합성을 억제하는데, P3%군에서 HFDW군에 비해 AMPK의 인산화가 유의하게 증가했다(Fig. 5).

지방이 생성될 때 세포 내 전사 인자인 C/EBP-α와 PPAR-γ가 이 과정을 촉진한다. C/EBP-α는 전지방 세포가 지방세포로 분화될 때 지방 생성에 가장 중요한 역할을 하는 전사인자이며, 과다 발현할 경우 과다한 지방세포 형성(adipogenesis)을 유도하는 역할을 한다. PPAR-γ 역시 지방세포의 전사조절 분자 중 하나로, 지방세포의 분화 및 지방합성과 저장에 관여하는 효소들의 발현을 조절한다32). 본 연구에서 PPAR-γ의 단백질 발현은 HFDW군에 비해 P3%군에서 감소하는 경향을 보였다(Fig. 5). 그리고 유전자 발현을 분석한 결과 mPPAR-γ은 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다(Fig. 6).

간에서의 지방 및 콜레스테롤 생성은 SREBPs의 발현 정도에 따라 결정된다. SREBP는 1a, c, 2로 분류되며, SREBP-1a, c는 대부분 지방산과 TG의 합성을 담당한다33). SREBP-1c는 P3%군에서 HFDW군에 비해 유의하게 감소하였다(Fig. 5). 또한 mSREBP-1c의 발현도 HFDW군에 비해 P3%군에서 유의하게 감소하였다(Fig. 6).

또한 AMPK가 인산화되어 활성화되면 CPT-1을 통한 미토콘드리아 내로의 LCFA-CoA의 이송을 증가시켜 지방산의 산화를 촉진한다고 알려져 있다34). CPT-1 단백질 발현은 NDW군에 비해 P1% 및 P3%군에서 유의하게 증가하였다(Fig. 5). 그리고 mCPT-1의 발현을 분석한 결과 HFDW군에 비해 P3%군에서 유의하게 증가하였다(Fig. 6).

HMGCR은 혈중 콜레스테롤을 조절하는 효소이다. 혈중 콜레스테롤이 높으면 효소의 합성이 낮아져 간으로의 콜레스테롤 이동이 촉진되며, 혈중 농도가 낮으면 효소의 발현이 증가하여 콜레스테롤 합성을 촉진한다35). 간 조직 내 mHMGCR 발현을 분석한 결과 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소하였다(Fig. 6).

대식세포의 이동 및 세포로의 침투를 조절하는 케모카인인 MCP-1은 비만 지방조직으로 대식세포를 동원하는 역할을 수행한다고 알려져 있다. 따라서 MCP-1의 발현은 지방조직에서 증가되는 것으로 나타난다36). mMCP-1 발현을 분석한 결과 HFDW군에 비해 P1% 및 P3%군에서 유의하게 감소되었다(Fig. 6).

간의 지방 대사와 관련된 단백질 및 유전자 발현을 분석한 결과, 薄荷 hydrosol은 생체 내의 에너지 인식 및 항상성 조절 및 당과 지방의 대사에 있어서 중요한 역할을 하는 AMPK 신호기전 및 ACC 경로를 통해서 지방의 합성을 억제하고, CPT-1을 증가시켜 지방산의 산화를 촉진한다고 볼 수 있다. 또한 간 PPAR-γ의 감소를 통해 지방세포의 분화와 간 조직 내 지방의 축적을 억제시키는 것으로 사료된다. 또한 SERBP-1c와 HMGCR의 제어를 통해 콜레스테롤 합성을 억제함으로써 혈중 콜레스테롤을 감소시킨 것으로 생각된다.

BAT의 미토콘드리아 내막에 존재하는 UCP-1은 지방을 산화하여 얻은 에너지를 열로 방출하는 역할을 한다37). mUCP-1 발현을 분석한 결과, HFDW군에 비해 P3%군에서 유의하게 증가했다. 또한 BAT의 mPPAR-γ 발현은 HFDW군에 비해 P1% 및 P3%군에서 감소된 경향을 보였다(Fig. 7). 위 결과를 종합하면 薄荷 hydrosol이 BAT에서 지방 산화를 촉진시켜 에너지를 소모함으로써 체내의 체지방 감소에 영향을 끼치는 것으로 사료된다. 이와 같은 薄荷 hydrosol의 항비만 효능은 이전 연구 보고16,17)처럼 hydrosol에 다량 함유되어 있는 menthol 성분과 관련성이 있는 것으로 보인다.

본 연구는 화장품에 자주 사용되는 hydrosol이라는 소재를 이용하여 薄荷의 항비만 효과를 알아봄으로써, 임상 활용의 범위를 확대하고자 하였다. 군별 섭취량의 차이에 통계적 유의성은 없었으나 엄격한 통제가 없었으며, 다양한 섭취 용량에서의 비교 실험이 이루어지지 않았으므로 용량 설정 등에서는 추후 심도 있는 연구가 필요할 것으로 보인다.

이상의 모든 결과를 종합하면 고지방 식이로 비만 유도된 생쥐에서 薄荷 hydrosol은 AMPK 경로 활성화를 통한 에너지 항상성 조절을 통해 지방세포 분화 억제뿐만 아니라 지방 합성 생성 억제 및 지방산 산화를 촉진함으로써 유의한 항비만 효과를 보여 주었다. 이는 薄荷 hydrosol이 비만 관련 천연 소재로서 식의약 분야의 활용 가능성에 대한 기초자료로 활용될 수 있을 것이다.

결론»»»

본 연구에서는 薄荷 hydrosol이 고지방 식이로 비만이 유발된 생쥐에 미치는 영향을 관찰하여 다음과 같은 결과를 얻었다.

  • 薄荷 hydrosol에서 menthol이 83.2%로 가장 많은 함량을 나타냈고, menthone의 함량은 5.94%로 나타났다.

  • 음용 7주 이후 P3%군에서의 체중이 유의하게 감소했다. 또한 P1% 및 P3%군에서 식이 섭취량이 감소하는 경향을 보였다.

  • 1주 동안 P1% 및 P3%군에서 유의하게 낮은 음수량을 보였으나, 2주째부터는 모든 군에서 음수량의 큰 차이가 나타나지 않았다.

  • 총 WAT 무게는 P1% 및 P3%군에서 유의하게 감소했다. P1% 및 P3%군에서의 간 무게가 NDW군과 비슷했고, 신장 무게는 P1% 및 P3%군에서 감소하는 경향을 보였다. 비복근과 가자미근 총 무게는 P1% 및 P3%군에서 유의하게 증가했다.

  • AST 수치는 P3%군에서 감소하는 경향을 보였고, 혈액 중 BUN 수치와 TG는 P1% 및 P3% 군에서 유의하게 감소했다. Glucose와 TC 수치는 P1% 및 P3%군에서 감소하는 경향을 보였다. HDL-C 수치는 P3%에서 유의하게 증가했고, AI는 P1% 및 P3%군에서 유의하게 감소했다.

  • P1% 및 P3%군에서 비대된 간세포의 감소 및 지방 변화 소견이 줄어들었다. 또한 P1% 및 P3%군에서 사구체 비대 양상이 개선되었으며, 부고환 지방조직 내 지방구의 크기 및 축적이 감소했다.

  • P3%군에서 AMPK의 인산화가 유의하게 증가했고, ACC의 인산화는 P1% 및 P3%군에서 증가하는 경향을 보였다. PPAR-γ의 발현은 P3%군에서 감소하는 경향을 보였다. SREBP-1c의 발현은 P3%군에서 유의하게 감소했고, CPT-1의 발현은 NDW군에 비해 P1% 및 P3%군에서 유의하게 증가했으며, HMGCR의 발현은 두 군 모두에서 감소하는 경향을 보였다.

  • P3%군에서 mSREBP-1c의 발현이 유의하게 감소했다. P1% 및 P3%군에서 mMCP-1과 mPPAR-γ의 발현은 유의하게 감소했고, mC/EBP-α 발현은 감소된 경향이 나타났다. mCPT-1의 발현은 P3%군에서 유의하게 증가했으며, mHMGCR의 발현은 P1% 및 P3%군에서 감소된 경향을 나타냈다.

  • P3%군에서 mUCP-1의 발현이 유의하게 증가했다. mPPAR-γ의 발현은 P1% 및 P3%군에서 감소하는 경향을 보였다.

이상의 결과를 볼 때, 薄荷 hydrosol의 음용은 고지방 식이로 유발된 비만 생쥐에서 AMPK 경로 활성화를 통해 지방세포 분화 억제, 지방 합성 억제 및 지방산 산화를 촉진함으로써 비만 치료에 효과적일 것으로 사료된다.

References
  1. Peng Y, Yu S, Li H, Xiang H, Peng J, Jiang S. MicroRNAs: emerging roles in adipogenesis and obesity. Cellular Signalling. 2014;26(9):1888-96.
    Pubmed CrossRef
  2. Na SY, Myung SJ. Obesity and colorectal cancer. Korean Journal of Gastroenterology. 2012;59(1):16-26.
    Pubmed CrossRef
  3. Jensen MD, Ryan DH, Apovian CM, Ard JD, Comuzzie AG, Donato KA. 2013 AHA/ACC/TOS guideline for the management of overweight and obesity in adults: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and The Obesity Society. Circulation. 2014;129(25):102-38.
    KoreaMed CrossRef
  4. Lee SY. Medical management of obesity. Korean Journal of Helicobacter and Upper Gastrointestinal Research. 2017;17(2):66-71.
    CrossRef
  5. James WP, Caterson ID, Coutinho W, Finer N, Van Gaal LF, Maggioni AP. Effect of sibutramine on cardiovascular outcomes in overweight and obese subjects. New England Journal of Medicine. 2013;363(10):905-17.
    Pubmed CrossRef
  6. Chang SH, Carolyn S, Song JH, Esteban V, Christopher J, Graham C. The effectiveness and risks of bariatric surgery an updated systematic review and meta-analysis, 2003-2012. JAMA Surgery. 2014;139(3):275-87.
    Pubmed KoreaMed CrossRef
  7. Sogo E, Zhou S, Haeiwa H, Takeda R, Okazaki K, Sekita M, Yamamoto T, Yamano M, Sakamoto K. Amber extract reduces lipid content in mature 3T3-L1 adipocytes by activating the lipolysis pathway. Molecules. 2021;26(15):4630.
    Pubmed KoreaMed CrossRef
  8. The Society of Korean Medicine Rehabilitation. Korean rehabilitation medicine. 4th ed. Koonja. 2015:303-5.
  9. Kim SJ, Seo YH, Lee HS, Chang HK, Cho JH, Kim KW, Song MY. Research trends of herbal medicines for obesity: mainly since 2015 to 2019. J Korean Med Rehabil. 2020;30(4):89-103.
    CrossRef
  10. Korean Medical College Society Textbook Compilation Committee. The herbology. Younglimsa. 2008:177-9.
  11. Cho HM, Sowndhararajan K, Jung JW, Jhoo JW, Kim SM. Fragrance chemicals in the essential oil of Mentha arvensis reduce levels of mental stress. Life Sciences. 2013;23(7):933-40.
    CrossRef
  12. Lim HS, Kim JH, Ha HK, Seo CS, Shin HK. Comparative study of the anti-inflammatory effects of Menthae Herba from Korea and China. Korean Journal of Pharmacognosy. 2012;43(3):231-8.
  13. Hong SW, Kim HA, Lee JM. Nutritional compositions of Lysimachia christinae Hance and Mentha canadensis and effect of Lysimachia christinae Hance on antioxidant properties. Korean Journal of Community Living Science. 2019;30(3):351-61.
    CrossRef
  14. Lee JH, Kim HJ, Jang GY, Seo KH, Kim MR, Choi YH, Jung JW. Mentha arvensis attenuates congnitive and memory impairment in scopolamine-treated mice. Korean Journal of Pharmacognosy. 2020;51(1):70-7.
  15. Badal RM, Badal D, Badal P, Khare A, Shrivastava J. Kumar V. Pharmacological action of Mentha piperita on lipid profile in fructose-fed rats. Iranian Journal of Pharmaceutical Research. 2011;10(4):843-8.
  16. Vizin RCL, Motzko-Soares ACP, Armentano GM, Ishikawa DT, Cruz-Neto AP, Carrettiero DC, Almeida MC. Short-term menthol treatment promotes persistent thermogenesis without induction of compensatory food consumption in wistar rats: implications for obesity control. Journal of Applied Physiology. 2018;124(3):672-83.
    Pubmed CrossRef
  17. Jiang CY, Zhai MZ, Yan D, Li C, Zhang YH, Xiao L, Xiong DJ, Deng Q, Sun WP. Dietary menthol-induced TRPM8 activation enhances WAT "browning" and ameliorates diet-induced obesity. Oncotarget. 2017;8(43):75114-26.
    Pubmed KoreaMed CrossRef
  18. Wojcik-Stopczynska B, Jakowienko P, Wysocka G. The estimation of antifungal activity of essential oil and hydrosol obtained from wrinkled-leaf mint (Mentha crispa L.). Herba Polonica. 2012;58(1):5-15.
  19. Kim MR, Choi BH, Kim HJ, Jo EB, Choi HA, Hong JI. Effects of zinc protoporphyrin on color responses of the Bradford and BCA protein assays. Journal of Natural Science. 2012;24:57-64.
    CrossRef
  20. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 2008;3(6):1101-8.
    Pubmed CrossRef
  21. Kim CS. Recent advances for anti-obesity agents. Journal of Korean Diabetes. 2015;16(4):260-8.
    CrossRef
  22. Houg HJ, Yang HY, Kang WY, Kim DG, Lee SY, Choi YH, Kim JH, Han CH, Lee YJ. Dangyuia (Citrus grandis Osbeck) peel improves lipid profiles and alleviates hypertension in rats fed a high-fat diet. Laboratory Animal Research. 2010;26(4):361-7.
    CrossRef
  23. de Sousa Guedes JP, da Costa Medeiros JA, de Souza e Silva RS, de Sousa JN, da Conceicao ML, de Souza EL. The efficacy of Mentha arvensis L. and M. piperita L. essential oils in reducing pathogenic bacteria and maintaining quality characteristics in cashew, guava, mango, and pineapple juices. International Journal of Food Microbiology. 2016;238:183-92.
    Pubmed CrossRef
  24. Benabdallah A, Boumendjel M, Aissi O, Rahmoune C, Boussaid M, Messaoud C. Chemical composition, antioxidant activity and acetylcholinesterase inhibitory of wild Mentha species from northeastern Algeria. South African Journal of Botany. 2018;116:131-9.
    CrossRef
  25. Baik JA, Baik JP, Cho Y, Chiang MH. Effect of floral water extracted from Elsholtzia ciliata, Acorus gramineus and Zanthoxylum schinifolium on quality and prolongation of vase life in cut rose. Journal of Natural Science. 2013;25:185-92.
  26. Makkar MK, Sharma S, Kaur H. Evaluation of Mentha arvensis essential oil and its major constituents for fungitoxicity. Journal of Food Science and Technology. 2018;55(9):3840-4.
    Pubmed KoreaMed CrossRef
  27. Mamta B, Pande C, Tewari G. Effect of copper amendments on the quality of essential oils extracted from the aerial parts of Mentha arvensis L. Journal of Essential Oil-bearing Plants. 2021;24(2):193-200.
    CrossRef
  28. Saely CH, Geiger K, Drexel H. Brown versus white adipose tissue: a mini-review. Gerontology. 2012;58(1):15-23.
    Pubmed CrossRef
  29. Jung DH, Kim JH. Relationships among muscle mass and obesity, metabolic syndrome, physical activity, and nutrient intake in elderly women: based on the 4th-5th (2008-2011) Korean national health and nutrition examination survey (KNHANES). Korean Journal of Community Living Science. 2018;29(4):469-83.
    CrossRef
  30. Kato S, Nazneen A, Nakashima Y, Rassaque MS, Nishino T, Furusu A. Pathological influence of obesity on renal structural changes in chronic kidney disease. Clinical and Experimental Nephrology. 2009;13(4):332-40.
    Pubmed CrossRef
  31. Choi MRN, Ha SM, Kim DY. Effects of elastic band exercise on body composition, blood lipids and AMPK in the elderly women. Journal of Korean Applied Science and Technology. 2019;36(3):995-1007.
  32. White UA. Stephens JM. Transcriptional factors that promote formation of white adipose tissue. Molecullar and Cellular Endocrinolgy. 2010;318(1-2):10-4.
    Pubmed KoreaMed CrossRef
  33. Yang X. Han M, Liu S, Yuan X, Liu X, Feng S, Zhou L, Li Y, Lu H, Cheng J, Lin S. HCBP6 upregulates human SREBP1c expression by binding to C/EBPβ-binding site in the SREBP1c promoter. BMB Reports. 2018;51(1):33-8.
    Pubmed KoreaMed CrossRef
  34. Park YM, Lim JH, Seo EW. Anti-obesity effect of by-product from soybean on mouse fed a high fat diet. Korean Journal of Plant Resources. 2015;28(2):168-77.
    CrossRef
  35. Wang HJ, Park JY, Kwon OB, Choe EY, Kim CH, Hur KY, Lee MS, Yun MJ, Cha BS, Kim YB, Lee HK, Kang ES. Chronic HMGCR/HMG-CoA reductase inhibitor treatment contributes to dysglycemia by upregulating hepatic gluconeogenesis through gutophagy induction. Autography. 2015;11(11):2089-101.
    Pubmed KoreaMed CrossRef
  36. Kim SH, Park BB, Hong SE, Ryu SR, Lee JH, Kim SH, Lee PJ, Cho EK, Moon C. Effects of 2-methoxy-1,4-naphthoquinone (MQ) on MCP-1 induced THP-1 migration. Korean Journal of Clinical Laboratory Science. 2019;51(2):245-51.
    CrossRef
  37. You YW, Lee CW, Jung JH, Kim YC, Lee DE, Park SH, Kim TS. Factors influencing the activation of brown adipose tissue in 18F-FDG PET/CT in national cancer center. Korean Journal of Nuclear Medicine Technology. 2021;25(1):21-8.


January 2024, 34 (1)

Cited By Articles
  • CrossRef (0)

  • Crossref TDM
  • CrossMark
  • orcid